Incidental Mutation 'R0736:Zbtb17'
ID 67286
Institutional Source Beutler Lab
Gene Symbol Zbtb17
Ensembl Gene ENSMUSG00000006215
Gene Name zinc finger and BTB domain containing 17
Synonyms mZ13, Zfp100, Miz1
MMRRC Submission 038917-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0736 (G1)
Quality Score 123
Status Not validated
Chromosome 4
Chromosomal Location 141171984-141195248 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 141189097 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 6 (H6N)
Ref Sequence ENSEMBL: ENSMUSP00000006377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006377]
AlphaFold Q60821
Predicted Effect probably damaging
Transcript: ENSMUST00000006377
AA Change: H6N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006377
Gene: ENSMUSG00000006215
AA Change: H6N

DomainStartEndE-ValueType
BTB 24 116 1.38e-27 SMART
low complexity region 203 222 N/A INTRINSIC
ZnF_C2H2 297 319 6.42e-4 SMART
ZnF_C2H2 325 347 3.11e-2 SMART
ZnF_C2H2 353 375 2.49e-1 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 8.47e-4 SMART
ZnF_C2H2 437 459 1.22e-4 SMART
ZnF_C2H2 465 487 4.94e-5 SMART
ZnF_C2H2 493 515 3.26e-5 SMART
ZnF_C2H2 521 543 7.26e-3 SMART
ZnF_C2H2 549 571 4.79e-3 SMART
ZnF_C2H2 577 599 1.58e-3 SMART
ZnF_C2H2 605 628 2.57e-3 SMART
low complexity region 654 674 N/A INTRINSIC
ZnF_C2H2 708 730 4.4e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144899
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein involved in the regulation of c-myc. The symbol MIZ1 has also been associated with PIAS2 which is a different gene located on chromosome 18. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryonic development of homozygous null mice is severely impaired and death occurs prior to E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amn1 G A 6: 149,084,970 (GRCm39) H37Y possibly damaging Het
Cacna2d3 A T 14: 28,780,585 (GRCm39) H644Q probably benign Het
Calb1 G A 4: 15,898,917 (GRCm39) V138M probably benign Het
Cep55 C A 19: 38,061,765 (GRCm39) T402N probably benign Het
Chrnb3 G A 8: 27,875,078 (GRCm39) A26T probably benign Het
Col6a3 C T 1: 90,731,811 (GRCm39) V1481I possibly damaging Het
Dmxl2 C T 9: 54,286,101 (GRCm39) V2695I probably damaging Het
Elapor2 A T 5: 9,491,745 (GRCm39) S702C probably damaging Het
Heatr5a A C 12: 51,943,344 (GRCm39) probably null Het
Kmt2c C T 5: 25,500,432 (GRCm39) M461I probably benign Het
Mapk9 G A 11: 49,774,081 (GRCm39) D413N possibly damaging Het
Morc4 G T X: 138,755,700 (GRCm39) Q239K probably benign Het
Myt1l T A 12: 29,877,813 (GRCm39) V488D unknown Het
Neb A T 2: 52,082,024 (GRCm39) Y24N probably damaging Het
Neo1 G A 9: 58,824,364 (GRCm39) P688L possibly damaging Het
Nlrp9b A T 7: 19,783,375 (GRCm39) D409V probably damaging Het
Pcare A G 17: 72,051,659 (GRCm39) V1231A probably benign Het
Pde7a T C 3: 19,285,207 (GRCm39) N327D probably damaging Het
Pdzd8 C A 19: 59,333,365 (GRCm39) V219L probably damaging Het
Pgc T A 17: 48,039,705 (GRCm39) M33K probably damaging Het
Pik3ap1 T A 19: 41,320,758 (GRCm39) T154S possibly damaging Het
Polm G C 11: 5,785,495 (GRCm39) S188C possibly damaging Het
Slfn1 A T 11: 83,011,907 (GRCm39) T8S probably benign Het
St8sia6 C T 2: 13,673,696 (GRCm39) V179M probably benign Het
Tns3 A T 11: 8,469,474 (GRCm39) F274I possibly damaging Het
Tspan5 T C 3: 138,574,159 (GRCm39) probably null Het
Utp14b A G 1: 78,642,989 (GRCm39) K296E probably damaging Het
Zbtb14 A G 17: 69,694,797 (GRCm39) E165G possibly damaging Het
Zw10 C T 9: 48,975,432 (GRCm39) H286Y probably benign Het
Other mutations in Zbtb17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Zbtb17 APN 4 141,193,678 (GRCm39) nonsense probably null
IGL01449:Zbtb17 APN 4 141,190,616 (GRCm39) missense probably benign
IGL01835:Zbtb17 APN 4 141,192,749 (GRCm39) critical splice donor site probably null
IGL02141:Zbtb17 APN 4 141,192,264 (GRCm39) missense probably damaging 1.00
IGL02142:Zbtb17 APN 4 141,192,293 (GRCm39) missense probably benign 0.29
IGL02167:Zbtb17 APN 4 141,189,140 (GRCm39) missense possibly damaging 0.94
IGL02388:Zbtb17 APN 4 141,189,224 (GRCm39) missense probably damaging 1.00
IGL02600:Zbtb17 APN 4 141,194,196 (GRCm39) missense possibly damaging 0.50
IGL02617:Zbtb17 APN 4 141,192,399 (GRCm39) missense probably damaging 0.97
IGL03290:Zbtb17 APN 4 141,194,244 (GRCm39) missense probably damaging 1.00
IGL03391:Zbtb17 APN 4 141,194,069 (GRCm39) missense probably damaging 1.00
IGL02799:Zbtb17 UTSW 4 141,190,691 (GRCm39) missense probably benign 0.20
R0698:Zbtb17 UTSW 4 141,193,407 (GRCm39) splice site probably null
R1924:Zbtb17 UTSW 4 141,191,914 (GRCm39) missense probably damaging 1.00
R1940:Zbtb17 UTSW 4 141,192,859 (GRCm39) missense possibly damaging 0.83
R2164:Zbtb17 UTSW 4 141,191,557 (GRCm39) missense probably benign
R2517:Zbtb17 UTSW 4 141,191,896 (GRCm39) missense probably damaging 1.00
R3424:Zbtb17 UTSW 4 141,192,299 (GRCm39) missense probably damaging 0.99
R3884:Zbtb17 UTSW 4 141,191,886 (GRCm39) missense probably damaging 1.00
R4609:Zbtb17 UTSW 4 141,193,809 (GRCm39) missense probably damaging 1.00
R5055:Zbtb17 UTSW 4 141,193,860 (GRCm39) missense possibly damaging 0.68
R5327:Zbtb17 UTSW 4 141,192,942 (GRCm39) missense probably benign 0.22
R5363:Zbtb17 UTSW 4 141,194,072 (GRCm39) missense probably benign 0.02
R5987:Zbtb17 UTSW 4 141,192,128 (GRCm39) missense possibly damaging 0.94
R6038:Zbtb17 UTSW 4 141,191,752 (GRCm39) missense probably benign 0.05
R6038:Zbtb17 UTSW 4 141,191,752 (GRCm39) missense probably benign 0.05
R6311:Zbtb17 UTSW 4 141,190,694 (GRCm39) missense probably benign 0.00
R6320:Zbtb17 UTSW 4 141,190,694 (GRCm39) missense probably benign 0.00
R6321:Zbtb17 UTSW 4 141,190,694 (GRCm39) missense probably benign 0.00
R6322:Zbtb17 UTSW 4 141,190,694 (GRCm39) missense probably benign 0.00
R6337:Zbtb17 UTSW 4 141,190,694 (GRCm39) missense probably benign 0.00
R6365:Zbtb17 UTSW 4 141,190,694 (GRCm39) missense probably benign 0.00
R6492:Zbtb17 UTSW 4 141,190,694 (GRCm39) missense probably benign 0.00
R6605:Zbtb17 UTSW 4 141,192,261 (GRCm39) missense probably damaging 0.99
R6695:Zbtb17 UTSW 4 141,189,110 (GRCm39) missense probably damaging 1.00
R7717:Zbtb17 UTSW 4 141,193,394 (GRCm39) missense probably damaging 1.00
R7999:Zbtb17 UTSW 4 141,189,134 (GRCm39) missense probably damaging 1.00
R8542:Zbtb17 UTSW 4 141,194,139 (GRCm39) unclassified probably benign
R8544:Zbtb17 UTSW 4 141,194,139 (GRCm39) unclassified probably benign
R8545:Zbtb17 UTSW 4 141,194,139 (GRCm39) unclassified probably benign
R8836:Zbtb17 UTSW 4 141,189,233 (GRCm39) missense possibly damaging 0.68
R9072:Zbtb17 UTSW 4 141,193,676 (GRCm39) missense possibly damaging 0.50
R9073:Zbtb17 UTSW 4 141,193,676 (GRCm39) missense possibly damaging 0.50
R9389:Zbtb17 UTSW 4 141,193,131 (GRCm39) missense possibly damaging 0.89
R9785:Zbtb17 UTSW 4 141,194,271 (GRCm39) missense possibly damaging 0.64
Z1176:Zbtb17 UTSW 4 141,190,990 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGACCGCATAATCGCTTTGCTTC -3'
(R):5'- GTCCTTCTGGTCCACAAAGAGCATC -3'

Sequencing Primer
(F):5'- TCGAGTAAGCTTTGGGAATGAC -3'
(R):5'- AGAGCATCTTGAAGTACTCGCTG -3'
Posted On 2013-09-03