Incidental Mutation 'R8818:Sppl2b'
ID672874
Institutional Source Beutler Lab
Gene Symbol Sppl2b
Ensembl Gene ENSMUSG00000035206
Gene Namesignal peptide peptidase like 2B
Synonyms3110056O03Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R8818 (G1)
Quality Score217.468
Status Not validated
Chromosome10
Chromosomal Location80855275-80868708 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TGTCACAGGT to TGT at 80866069 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000220091]
Predicted Effect probably null
Transcript: ENSMUST00000035597
SMART Domains Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:PA 55 147 5.5e-14 PFAM
transmembrane domain 167 189 N/A INTRINSIC
PSN 210 485 2.16e-113 SMART
low complexity region 520 531 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218789
Predicted Effect probably benign
Transcript: ENSMUST00000219614
Predicted Effect probably null
Transcript: ENSMUST00000219951
Predicted Effect probably null
Transcript: ENSMUST00000220091
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T G 3: 36,996,548 M3011R possibly damaging Het
Abca14 G T 7: 120,216,301 M257I probably benign Het
Adam23 T C 1: 63,545,468 V345A probably damaging Het
Anxa6 T G 11: 55,011,752 N52T possibly damaging Het
Arhgef15 G A 11: 68,951,112 H496Y probably damaging Het
Atp2a3 A G 11: 72,981,939 E771G probably damaging Het
B3gnt5 A G 16: 19,769,597 T189A possibly damaging Het
Becn1 A T 11: 101,295,404 S125T probably damaging Het
Ccdc180 A G 4: 45,900,484 M283V probably benign Het
Cdh17 T C 4: 11,771,323 F35S probably damaging Het
Clcn1 T A 6: 42,305,543 I515N probably damaging Het
Cyp4f17 A G 17: 32,524,094 Y247C probably damaging Het
Dcp1a T A 14: 30,518,942 H236Q possibly damaging Het
Dnah11 T A 12: 117,911,029 N4034Y probably damaging Het
Dsg1a A G 18: 20,340,542 I891V possibly damaging Het
Eid3 A G 10: 82,867,607 N301D probably damaging Het
Fbrs C A 7: 127,479,522 D108E unknown Het
Fbxw14 A C 9: 109,287,003 probably benign Het
Fzd8 A G 18: 9,214,474 T519A probably benign Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Gm35911 A T 5: 99,941,235 N120Y probably damaging Het
Gpr3 C A 4: 133,211,227 V45L possibly damaging Het
Gramd1b A T 9: 40,304,484 I690K probably benign Het
Grhl2 T A 15: 37,270,668 D33E probably damaging Het
Kcnj4 C A 15: 79,485,719 R20L probably damaging Het
Klhl5 A G 5: 65,148,646 I319V probably benign Het
Lars2 A T 9: 123,392,827 E135D possibly damaging Het
Map9 T A 3: 82,383,963 Y602N possibly damaging Het
Mphosph9 A T 5: 124,324,964 L6* probably null Het
Naa35 C T 13: 59,600,947 T131M probably damaging Het
Nucb2 T A 7: 116,521,901 L22Q possibly damaging Het
Olfr1066 C A 2: 86,455,734 C179F probably damaging Het
Olfr943 A G 9: 39,184,766 Y193C probably damaging Het
Pcdhb6 C T 18: 37,335,784 T586I probably benign Het
Ppcs A T 4: 119,422,133 L74Q probably damaging Het
Ppp6r3 A T 19: 3,467,216 V677D probably benign Het
Psg27 C T 7: 18,560,412 G357S probably damaging Het
Ptgdr2 A G 19: 10,941,016 N299S probably damaging Het
Relb T A 7: 19,619,837 I39F probably damaging Het
Ripor2 T A 13: 24,717,668 S907R possibly damaging Het
Rnf170 T G 8: 26,139,015 D172E probably benign Het
Rnf31 C A 14: 55,594,939 Q273K probably benign Het
Rrp36 A T 17: 46,672,410 S93T probably damaging Het
Rsad1 A T 11: 94,548,274 V120D probably benign Het
Ryr3 C T 2: 112,831,096 A1870T probably damaging Het
Serpina10 T G 12: 103,628,804 D52A probably benign Het
Slc47a1 A G 11: 61,370,229 I115T probably benign Het
Spag17 T A 3: 100,013,227 M426K probably benign Het
Sptbn4 T G 7: 27,364,167 E2283A possibly damaging Het
Top3a A G 11: 60,743,051 C740R probably damaging Het
Tpgs2 A T 18: 25,158,308 V33E probably damaging Het
Treh T C 9: 44,681,526 I116T probably damaging Het
Trpm3 A T 19: 22,978,588 N1138I possibly damaging Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Zswim9 G T 7: 13,260,529 Q567K probably benign Het
Other mutations in Sppl2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Sppl2b APN 10 80864094 missense probably damaging 1.00
IGL01835:Sppl2b APN 10 80865341 missense probably damaging 0.99
IGL01836:Sppl2b APN 10 80861386 missense probably benign 0.00
IGL01964:Sppl2b APN 10 80865386 critical splice donor site probably null
IGL02376:Sppl2b APN 10 80867598 nonsense probably null
R1641:Sppl2b UTSW 10 80865131 missense probably damaging 0.96
R2228:Sppl2b UTSW 10 80865617 missense probably damaging 1.00
R3104:Sppl2b UTSW 10 80867491 missense probably benign 0.00
R3106:Sppl2b UTSW 10 80867491 missense probably benign 0.00
R4350:Sppl2b UTSW 10 80862726 missense probably benign 0.12
R5146:Sppl2b UTSW 10 80867640 makesense probably null
R5698:Sppl2b UTSW 10 80866045 splice site probably null
R6969:Sppl2b UTSW 10 80865125 missense probably damaging 1.00
R7649:Sppl2b UTSW 10 80867419 missense probably benign 0.02
R8212:Sppl2b UTSW 10 80865359 missense probably damaging 1.00
R8263:Sppl2b UTSW 10 80866069 frame shift probably null
R8265:Sppl2b UTSW 10 80866069 frame shift probably null
R8367:Sppl2b UTSW 10 80863191 missense probably benign 0.02
R8398:Sppl2b UTSW 10 80866068 frame shift probably null
R8398:Sppl2b UTSW 10 80866069 frame shift probably null
R8400:Sppl2b UTSW 10 80866069 frame shift probably null
R8480:Sppl2b UTSW 10 80866069 frame shift probably null
R8481:Sppl2b UTSW 10 80866069 frame shift probably null
R8505:Sppl2b UTSW 10 80866069 frame shift probably null
R8817:Sppl2b UTSW 10 80866069 frame shift probably null
R8832:Sppl2b UTSW 10 80866069 frame shift probably null
Z1176:Sppl2b UTSW 10 80867425 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- ATGTGCATGCCCATTGTCAC -3'
(R):5'- CTTGGGCCAGACACTCAACTAC -3'

Sequencing Primer
(F):5'- ATTGTCACCATCCACCTGGCAG -3'
(R):5'- GGGCCAGACACTCAACTACTCAAG -3'
Posted On2021-04-30