Mutagenetix > Incidental Mutation

Incidental Mutation 'R8818:Gldc'

672902

Institutional Source

Beutler Lab

Gene Symbol

Gldc

Ensembl Gene

ENSMUSG00000024827

Gene Name

glycine decarboxylase

Synonyms

D030049L12Rik, D19Wsu57e

MMRRC Submission

Accession Numbers

Genbank: NM_138595.1

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8818 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30098449-30175418 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 30100812 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 928 (M928I)

Ref Sequence

ENSEMBL: ENSMUSP00000025778 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025778]

AlphaFold

Q91W43

Predicted Effect

probably benign
Transcript: ENSMUST00000025778
AA Change: M928I

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: M928I

Domain	Start	End	E-Value	Type
low complexity region	5	28	N/A	INTRINSIC
low complexity region	33	56	N/A	INTRINSIC
Pfam:GDC-P	70	493	1.1e-202	PFAM
low complexity region	504	515	N/A	INTRINSIC
Pfam:GDC-P	519	798	6.5e-8	PFAM
Pfam:Beta_elim_lyase	589	745	2e-10	PFAM

Meta Mutation Damage Score

0.1865

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	G	3: 36,996,548	M3011R	possibly damaging	Het
Abca14	G	T	7: 120,216,301	M257I	probably benign	Het
Adam23	T	C	1: 63,545,468	V345A	probably damaging	Het
Anxa6	T	G	11: 55,011,752	N52T	possibly damaging	Het
Arhgef15	G	A	11: 68,951,112	H496Y	probably damaging	Het
Atp2a3	A	G	11: 72,981,939	E771G	probably damaging	Het
B3gnt5	A	G	16: 19,769,597	T189A	possibly damaging	Het
Becn1	A	T	11: 101,295,404	S125T	probably damaging	Het
Ccdc180	A	G	4: 45,900,484	M283V	probably benign	Het
Cdh17	T	C	4: 11,771,323	F35S	probably damaging	Het
Clcn1	T	A	6: 42,305,543	I515N	probably damaging	Het
Cyp4f17	A	G	17: 32,524,094	Y247C	probably damaging	Het
Dcp1a	T	A	14: 30,518,942	H236Q	possibly damaging	Het
Dnah11	T	A	12: 117,911,029	N4034Y	probably damaging	Het
Dsg1a	A	G	18: 20,340,542	I891V	possibly damaging	Het
Eid3	A	G	10: 82,867,607	N301D	probably damaging	Het
Fbrs	C	A	7: 127,479,522	D108E	unknown	Het
Fbxw14	A	C	9: 109,287,003		probably benign	Het
Fzd8	A	G	18: 9,214,474	T519A	probably benign	Het
Gm35911	A	T	5: 99,941,235	N120Y	probably damaging	Het
Gpr3	C	A	4: 133,211,227	V45L	possibly damaging	Het
Gramd1b	A	T	9: 40,304,484	I690K	probably benign	Het
Grhl2	T	A	15: 37,270,668	D33E	probably damaging	Het
Kcnj4	C	A	15: 79,485,719	R20L	probably damaging	Het
Klhl5	A	G	5: 65,148,646	I319V	probably benign	Het
Lars2	A	T	9: 123,392,827	E135D	possibly damaging	Het
Map9	T	A	3: 82,383,963	Y602N	possibly damaging	Het
Mphosph9	A	T	5: 124,324,964	L6*	probably null	Het
Naa35	C	T	13: 59,600,947	T131M	probably damaging	Het
Nucb2	T	A	7: 116,521,901	L22Q	possibly damaging	Het
Olfr1066	C	A	2: 86,455,734	C179F	probably damaging	Het
Olfr943	A	G	9: 39,184,766	Y193C	probably damaging	Het
Pcdhb6	C	T	18: 37,335,784	T586I	probably benign	Het
Ppcs	A	T	4: 119,422,133	L74Q	probably damaging	Het
Ppp6r3	A	T	19: 3,467,216	V677D	probably benign	Het
Psg27	C	T	7: 18,560,412	G357S	probably damaging	Het
Ptgdr2	A	G	19: 10,941,016	N299S	probably damaging	Het
Relb	T	A	7: 19,619,837	I39F	probably damaging	Het
Ripor2	T	A	13: 24,717,668	S907R	possibly damaging	Het
Rnf170	T	G	8: 26,139,015	D172E	probably benign	Het
Rnf31	C	A	14: 55,594,939	Q273K	probably benign	Het
Rrp36	A	T	17: 46,672,410	S93T	probably damaging	Het
Rsad1	A	T	11: 94,548,274	V120D	probably benign	Het
Ryr3	C	T	2: 112,831,096	A1870T	probably damaging	Het
Serpina10	T	G	12: 103,628,804	D52A	probably benign	Het
Slc47a1	A	G	11: 61,370,229	I115T	probably benign	Het
Spag17	T	A	3: 100,013,227	M426K	probably benign	Het
Sppl2b	TGTCACAGGT	TGT	10: 80,866,069		probably null	Het
Sptbn4	T	G	7: 27,364,167	E2283A	possibly damaging	Het
Top3a	A	G	11: 60,743,051	C740R	probably damaging	Het
Tpgs2	A	T	18: 25,158,308	V33E	probably damaging	Het
Treh	T	C	9: 44,681,526	I116T	probably damaging	Het
Trpm3	A	T	19: 22,978,588	N1138I	possibly damaging	Het
Unc13d	AATGCCTCCCATGCC	AATGCCTCCCATGCCTCCCATGCC	11: 116,068,172		probably benign	Het
Zswim9	G	T	7: 13,260,529	Q567K	probably benign	Het

Other mutations in Gldc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Gldc	APN	19	30115240	missense	probably damaging	1.00
IGL01016:Gldc	APN	19	30133493	missense	possibly damaging	0.93
IGL01112:Gldc	APN	19	30158513	critical splice donor site	probably null
IGL01510:Gldc	APN	19	30113721	critical splice donor site	probably null
IGL01516:Gldc	APN	19	30099032	missense	probably damaging	1.00
IGL01598:Gldc	APN	19	30133756	missense	probably damaging	1.00
IGL01646:Gldc	APN	19	30100765	missense	possibly damaging	0.61
IGL02024:Gldc	APN	19	30100827	missense	probably damaging	1.00
IGL02125:Gldc	APN	19	30147241	missense	probably benign	0.03
IGL02548:Gldc	APN	19	30099899	missense	probably benign
IGL02711:Gldc	APN	19	30145146	critical splice donor site	probably null
IGL02818:Gldc	APN	19	30136509	missense	probably damaging	0.99
IGL02982:Gldc	APN	19	30145145	critical splice donor site	probably null
IGL03165:Gldc	APN	19	30098993	missense	possibly damaging	0.61
jojoba	UTSW	19	30133512	missense	probably damaging	1.00
miserable	UTSW	19	30151536	missense	probably damaging	1.00
Urchin	UTSW	19	30118602	missense	probably damaging	0.98
I2289:Gldc	UTSW	19	30147176	nonsense	probably null
R0180:Gldc	UTSW	19	30100817	missense	possibly damaging	0.95
R0269:Gldc	UTSW	19	30118602	missense	probably damaging	0.98
R0277:Gldc	UTSW	19	30116451	missense	possibly damaging	0.84
R1085:Gldc	UTSW	19	30151428	missense	probably damaging	1.00
R1159:Gldc	UTSW	19	30160762	intron	probably benign
R1500:Gldc	UTSW	19	30113825	missense	possibly damaging	0.88
R1507:Gldc	UTSW	19	30118638	missense	probably damaging	1.00
R1592:Gldc	UTSW	19	30160677	intron	probably benign
R1593:Gldc	UTSW	19	30113750	missense	probably damaging	1.00
R1675:Gldc	UTSW	19	30143453	missense	probably damaging	1.00
R1869:Gldc	UTSW	19	30139332	missense	probably benign
R1965:Gldc	UTSW	19	30137113	nonsense	probably null
R2312:Gldc	UTSW	19	30100826	missense	probably damaging	0.98
R2425:Gldc	UTSW	19	30131790	missense	probably damaging	1.00
R3836:Gldc	UTSW	19	30118675	splice site	probably benign
R3837:Gldc	UTSW	19	30118675	splice site	probably benign
R3839:Gldc	UTSW	19	30118675	splice site	probably benign
R4191:Gldc	UTSW	19	30145658	missense	probably damaging	0.96
R4380:Gldc	UTSW	19	30160768	intron	probably benign
R4508:Gldc	UTSW	19	30143407	missense	probably damaging	1.00
R4570:Gldc	UTSW	19	30174439	missense	probably benign
R4655:Gldc	UTSW	19	30160702	intron	probably benign
R4842:Gldc	UTSW	19	30133732	missense	possibly damaging	0.94
R5070:Gldc	UTSW	19	30118598	missense	possibly damaging	0.84
R5085:Gldc	UTSW	19	30151536	missense	probably damaging	1.00
R5268:Gldc	UTSW	19	30145725	missense	probably damaging	0.96
R5368:Gldc	UTSW	19	30158521	missense	probably benign
R5718:Gldc	UTSW	19	30110772	nonsense	probably null
R5878:Gldc	UTSW	19	30143467	splice site	probably null
R6192:Gldc	UTSW	19	30133772	missense	probably damaging	0.98
R6453:Gldc	UTSW	19	30116517	missense	probably damaging	0.99
R6777:Gldc	UTSW	19	30133512	missense	probably damaging	1.00
R6865:Gldc	UTSW	19	30133762	missense	possibly damaging	0.92
R7332:Gldc	UTSW	19	30116526	missense	probably damaging	0.99
R7390:Gldc	UTSW	19	30099914	missense	possibly damaging	0.46
R7647:Gldc	UTSW	19	30118667	missense	probably damaging	0.96
R8081:Gldc	UTSW	19	30158587	frame shift	probably null
R8171:Gldc	UTSW	19	30133761	missense	probably benign	0.24
R8321:Gldc	UTSW	19	30143407	nonsense	probably null
R8374:Gldc	UTSW	19	30137194	missense	probably damaging	1.00
R8503:Gldc	UTSW	19	30099854	missense	probably benign	0.26
R8510:Gldc	UTSW	19	30116505	missense	probably damaging	1.00
R8785:Gldc	UTSW	19	30115234	missense	probably damaging	1.00
R8820:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8829:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8830:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8859:Gldc	UTSW	19	30139379	missense	probably damaging	1.00
R8887:Gldc	UTSW	19	30133756	missense	possibly damaging	0.94
R8935:Gldc	UTSW	19	30131693	missense	probably benign	0.00
R8940:Gldc	UTSW	19	30151484	missense	probably benign
R9070:Gldc	UTSW	19	30103004	missense	probably damaging	1.00
R9100:Gldc	UTSW	19	30099914	missense	possibly damaging	0.81
R9144:Gldc	UTSW	19	30137193	missense
R9163:Gldc	UTSW	19	30134286	missense	probably benign	0.13
R9429:Gldc	UTSW	19	30113772	missense	possibly damaging	0.88
Z1177:Gldc	UTSW	19	30110778	missense	probably damaging	1.00
Z1177:Gldc	UTSW	19	30110779	missense	probably damaging	0.99
Z1177:Gldc	UTSW	19	30145748	missense	possibly damaging	0.61

Predicted Primers

PCR Primer
(F):5'- CAGCCATTCGAGATTGAAACCTC -3'
(R):5'- GTCCTGCTACTACATAGACGTACC -3'

Sequencing Primer
(F):5'- CGAGATTGAAACCTCTGTGTTTC -3'
(R):5'- TGCTTGTAAAAGCCATGCTAC -3'

Posted On

2021-04-30