Incidental Mutation 'R8818:Gldc'
ID672902
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Nameglycine decarboxylase
SynonymsD030049L12Rik, D19Wsu57e
Accession Numbers

Genbank: NM_138595.1

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8818 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location30098449-30175418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 30100812 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 928 (M928I)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
Predicted Effect probably benign
Transcript: ENSMUST00000025778
AA Change: M928I

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: M928I

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T G 3: 36,996,548 M3011R possibly damaging Het
Abca14 G T 7: 120,216,301 M257I probably benign Het
Adam23 T C 1: 63,545,468 V345A probably damaging Het
Anxa6 T G 11: 55,011,752 N52T possibly damaging Het
Arhgef15 G A 11: 68,951,112 H496Y probably damaging Het
Atp2a3 A G 11: 72,981,939 E771G probably damaging Het
B3gnt5 A G 16: 19,769,597 T189A possibly damaging Het
Becn1 A T 11: 101,295,404 S125T probably damaging Het
Ccdc180 A G 4: 45,900,484 M283V probably benign Het
Cdh17 T C 4: 11,771,323 F35S probably damaging Het
Clcn1 T A 6: 42,305,543 I515N probably damaging Het
Cyp4f17 A G 17: 32,524,094 Y247C probably damaging Het
Dcp1a T A 14: 30,518,942 H236Q possibly damaging Het
Dnah11 T A 12: 117,911,029 N4034Y probably damaging Het
Dsg1a A G 18: 20,340,542 I891V possibly damaging Het
Eid3 A G 10: 82,867,607 N301D probably damaging Het
Fbrs C A 7: 127,479,522 D108E unknown Het
Fbxw14 A C 9: 109,287,003 probably benign Het
Fzd8 A G 18: 9,214,474 T519A probably benign Het
Gm35911 A T 5: 99,941,235 N120Y probably damaging Het
Gpr3 C A 4: 133,211,227 V45L possibly damaging Het
Gramd1b A T 9: 40,304,484 I690K probably benign Het
Grhl2 T A 15: 37,270,668 D33E probably damaging Het
Kcnj4 C A 15: 79,485,719 R20L probably damaging Het
Klhl5 A G 5: 65,148,646 I319V probably benign Het
Lars2 A T 9: 123,392,827 E135D possibly damaging Het
Map9 T A 3: 82,383,963 Y602N possibly damaging Het
Mphosph9 A T 5: 124,324,964 L6* probably null Het
Naa35 C T 13: 59,600,947 T131M probably damaging Het
Nucb2 T A 7: 116,521,901 L22Q possibly damaging Het
Olfr1066 C A 2: 86,455,734 C179F probably damaging Het
Olfr943 A G 9: 39,184,766 Y193C probably damaging Het
Pcdhb6 C T 18: 37,335,784 T586I probably benign Het
Ppcs A T 4: 119,422,133 L74Q probably damaging Het
Ppp6r3 A T 19: 3,467,216 V677D probably benign Het
Psg27 C T 7: 18,560,412 G357S probably damaging Het
Ptgdr2 A G 19: 10,941,016 N299S probably damaging Het
Relb T A 7: 19,619,837 I39F probably damaging Het
Ripor2 T A 13: 24,717,668 S907R possibly damaging Het
Rnf170 T G 8: 26,139,015 D172E probably benign Het
Rnf31 C A 14: 55,594,939 Q273K probably benign Het
Rrp36 A T 17: 46,672,410 S93T probably damaging Het
Rsad1 A T 11: 94,548,274 V120D probably benign Het
Ryr3 C T 2: 112,831,096 A1870T probably damaging Het
Serpina10 T G 12: 103,628,804 D52A probably benign Het
Slc47a1 A G 11: 61,370,229 I115T probably benign Het
Spag17 T A 3: 100,013,227 M426K probably benign Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Sptbn4 T G 7: 27,364,167 E2283A possibly damaging Het
Top3a A G 11: 60,743,051 C740R probably damaging Het
Tpgs2 A T 18: 25,158,308 V33E probably damaging Het
Treh T C 9: 44,681,526 I116T probably damaging Het
Trpm3 A T 19: 22,978,588 N1138I possibly damaging Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Zswim9 G T 7: 13,260,529 Q567K probably benign Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30115240 missense probably damaging 1.00
IGL01016:Gldc APN 19 30133493 missense possibly damaging 0.93
IGL01112:Gldc APN 19 30158513 critical splice donor site probably null
IGL01510:Gldc APN 19 30113721 critical splice donor site probably null
IGL01516:Gldc APN 19 30099032 missense probably damaging 1.00
IGL01598:Gldc APN 19 30133756 missense probably damaging 1.00
IGL01646:Gldc APN 19 30100765 missense possibly damaging 0.61
IGL02024:Gldc APN 19 30100827 missense probably damaging 1.00
IGL02125:Gldc APN 19 30147241 missense probably benign 0.03
IGL02548:Gldc APN 19 30099899 missense probably benign
IGL02711:Gldc APN 19 30145146 critical splice donor site probably null
IGL02818:Gldc APN 19 30136509 missense probably damaging 0.99
IGL02982:Gldc APN 19 30145145 critical splice donor site probably null
IGL03165:Gldc APN 19 30098993 missense possibly damaging 0.61
jojoba UTSW 19 30133512 missense probably damaging 1.00
miserable UTSW 19 30151536 missense probably damaging 1.00
Urchin UTSW 19 30118602 missense probably damaging 0.98
I2289:Gldc UTSW 19 30147176 nonsense probably null
R0180:Gldc UTSW 19 30100817 missense possibly damaging 0.95
R0269:Gldc UTSW 19 30118602 missense probably damaging 0.98
R0277:Gldc UTSW 19 30116451 missense possibly damaging 0.84
R1085:Gldc UTSW 19 30151428 missense probably damaging 1.00
R1159:Gldc UTSW 19 30160762 intron probably benign
R1500:Gldc UTSW 19 30113825 missense possibly damaging 0.88
R1507:Gldc UTSW 19 30118638 missense probably damaging 1.00
R1592:Gldc UTSW 19 30160677 intron probably benign
R1593:Gldc UTSW 19 30113750 missense probably damaging 1.00
R1675:Gldc UTSW 19 30143453 missense probably damaging 1.00
R1869:Gldc UTSW 19 30139332 missense probably benign
R1965:Gldc UTSW 19 30137113 nonsense probably null
R2312:Gldc UTSW 19 30100826 missense probably damaging 0.98
R2425:Gldc UTSW 19 30131790 missense probably damaging 1.00
R3836:Gldc UTSW 19 30118675 splice site probably benign
R3837:Gldc UTSW 19 30118675 splice site probably benign
R3839:Gldc UTSW 19 30118675 splice site probably benign
R4191:Gldc UTSW 19 30145658 missense probably damaging 0.96
R4380:Gldc UTSW 19 30160768 intron probably benign
R4508:Gldc UTSW 19 30143407 missense probably damaging 1.00
R4570:Gldc UTSW 19 30174439 missense probably benign
R4655:Gldc UTSW 19 30160702 intron probably benign
R4842:Gldc UTSW 19 30133732 missense possibly damaging 0.94
R5070:Gldc UTSW 19 30118598 missense possibly damaging 0.84
R5085:Gldc UTSW 19 30151536 missense probably damaging 1.00
R5268:Gldc UTSW 19 30145725 missense probably damaging 0.96
R5368:Gldc UTSW 19 30158521 missense probably benign
R5718:Gldc UTSW 19 30110772 nonsense probably null
R5878:Gldc UTSW 19 30143467 splice site probably null
R6192:Gldc UTSW 19 30133772 missense probably damaging 0.98
R6453:Gldc UTSW 19 30116517 missense probably damaging 0.99
R6777:Gldc UTSW 19 30133512 missense probably damaging 1.00
R6865:Gldc UTSW 19 30133762 missense possibly damaging 0.92
R7332:Gldc UTSW 19 30116526 missense probably damaging 0.99
R7390:Gldc UTSW 19 30099914 missense possibly damaging 0.46
R7647:Gldc UTSW 19 30118667 missense probably damaging 0.96
R8081:Gldc UTSW 19 30158587 frame shift probably null
R8171:Gldc UTSW 19 30133761 missense probably benign 0.24
R8321:Gldc UTSW 19 30143407 nonsense probably null
R8374:Gldc UTSW 19 30137194 missense probably damaging 1.00
R8503:Gldc UTSW 19 30099854 missense probably benign 0.26
R8510:Gldc UTSW 19 30116505 missense probably damaging 1.00
R8785:Gldc UTSW 19 30115234 missense probably damaging 1.00
R8820:Gldc UTSW 19 30100812 missense probably benign 0.05
R8829:Gldc UTSW 19 30100812 missense probably benign 0.05
R8830:Gldc UTSW 19 30100812 missense probably benign 0.05
R8859:Gldc UTSW 19 30139379 missense probably damaging 1.00
R8887:Gldc UTSW 19 30133756 missense possibly damaging 0.94
R8935:Gldc UTSW 19 30131693 missense probably benign 0.00
R8940:Gldc UTSW 19 30151484 missense probably benign
Z1177:Gldc UTSW 19 30110778 missense probably damaging 1.00
Z1177:Gldc UTSW 19 30110779 missense probably damaging 0.99
Z1177:Gldc UTSW 19 30145748 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CAGCCATTCGAGATTGAAACCTC -3'
(R):5'- GTCCTGCTACTACATAGACGTACC -3'

Sequencing Primer
(F):5'- CGAGATTGAAACCTCTGTGTTTC -3'
(R):5'- TGCTTGTAAAAGCCATGCTAC -3'
Posted On2021-04-30