Mutagenetix > Incidental Mutations

Incidental Mutation 'R0736:Nlrp9b'

67291

Institutional Source

Beutler Lab

Gene Symbol

Nlrp9b

Ensembl Gene

ENSMUSG00000060508

Gene Name

NLR family, pyrin domain containing 9B

Synonyms

Nalp-delta, Nalp9b

MMRRC Submission

038917-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0736 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

19991465-20073306 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20049450 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 409 (D409V)

Ref Sequence

ENSEMBL: ENSMUSP00000113762 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073151] [ENSMUST00000117909]

Predicted Effect

probably benign
Transcript: ENSMUST00000073151
AA Change: D906V

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000072895
Gene: ENSMUSG00000060508
AA Change: D906V

Domain	Start	End	E-Value	Type
PYRIN	5	87	2.08e-23	SMART
Pfam:NACHT	143	311	4.3e-34	PFAM
low complexity region	580	595	N/A	INTRINSIC
LRR	630	657	2.16e2	SMART
LRR	691	718	2.23e2	SMART
LRR	747	774	6.67e-2	SMART
LRR	776	803	3.65e0	SMART
LRR	804	831	5.59e-4	SMART
LRR	833	860	2.81e0	SMART
LRR	861	888	8.87e-7	SMART
LRR	890	917	9.24e1	SMART
Blast:LRR	918	945	2e-8	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000117909
AA Change: D409V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113762
Gene: ENSMUSG00000060508
AA Change: D409V

Domain	Start	End	E-Value	Type
PYRIN	5	87	2.08e-23	SMART
Pfam:NACHT	143	179	2.8e-6	PFAM
LRR	190	217	2.16e2	SMART
LRR	251	278	2.23e2	SMART
LRR	307	334	6.67e-2	SMART
LRR	336	363	3.65e0	SMART
LRR	364	391	5.59e-4	SMART
LRR	393	420	2.81e0	SMART
Pfam:Chromo_shadow	450	501	2.9e-25	PFAM

Coding Region Coverage

1x: 99.6%
3x: 99.0%
10x: 97.6%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NALP protein family. Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). This protein may play a regulatory role in the innate immune system as similar family members belong to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. [provided by RefSeq, Jul 2008]
PHENOTYPE: The protein protects against rotavirus infection. Homozygous KO leads to increased susceptibility to infection and greater severity of pathology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	A	T	5: 9,441,745	S702C	probably damaging	Het
Amn1	G	A	6: 149,183,472	H37Y	possibly damaging	Het
BC027072	A	G	17: 71,744,664	V1231A	probably benign	Het
Cacna2d3	A	T	14: 29,058,628	H644Q	probably benign	Het
Calb1	G	A	4: 15,898,917	V138M	probably benign	Het
Cep55	C	A	19: 38,073,317	T402N	probably benign	Het
Chrnb3	G	A	8: 27,385,050	A26T	probably benign	Het
Col6a3	C	T	1: 90,804,089	V1481I	possibly damaging	Het
Dmxl2	C	T	9: 54,378,817	V2695I	probably damaging	Het
Heatr5a	A	C	12: 51,896,561		probably null	Het
Kmt2c	C	T	5: 25,295,434	M461I	probably benign	Het
Mapk9	G	A	11: 49,883,254	D413N	possibly damaging	Het
Morc4	G	T	X: 139,854,951	Q239K	probably benign	Het
Myt1l	T	A	12: 29,827,814	V488D	unknown	Het
Neb	A	T	2: 52,192,012	Y24N	probably damaging	Het
Neo1	G	A	9: 58,917,081	P688L	possibly damaging	Het
Pde7a	T	C	3: 19,231,043	N327D	probably damaging	Het
Pdzd8	C	A	19: 59,344,933	V219L	probably damaging	Het
Pgc	T	A	17: 47,728,780	M33K	probably damaging	Het
Pik3ap1	T	A	19: 41,332,319	T154S	possibly damaging	Het
Polm	G	C	11: 5,835,495	S188C	possibly damaging	Het
Slfn1	A	T	11: 83,121,081	T8S	probably benign	Het
St8sia6	C	T	2: 13,668,885	V179M	probably benign	Het
Tns3	A	T	11: 8,519,474	F274I	possibly damaging	Het
Tspan5	T	C	3: 138,868,398		probably null	Het
Utp14b	A	G	1: 78,665,272	K296E	probably damaging	Het
Zbtb14	A	G	17: 69,387,802	E165G	possibly damaging	Het
Zbtb17	C	A	4: 141,461,786	H6N	probably damaging	Het
Zw10	C	T	9: 49,064,132	H286Y	probably benign	Het

Other mutations in Nlrp9b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Nlrp9b	APN	7	20023278	missense	probably benign	0.43
IGL00675:Nlrp9b	APN	7	20023186	missense	possibly damaging	0.63
IGL00755:Nlrp9b	APN	7	20023522	missense	probably damaging	1.00
IGL01131:Nlrp9b	APN	7	20023537	missense	probably damaging	1.00
IGL01134:Nlrp9b	APN	7	20023187	missense	probably benign	0.06
IGL01464:Nlrp9b	APN	7	20062655	missense	probably benign	0.00
IGL01514:Nlrp9b	APN	7	20045934	critical splice donor site	probably null
IGL01731:Nlrp9b	APN	7	20023417	nonsense	probably null
IGL02427:Nlrp9b	APN	7	20042501	missense	probably damaging	1.00
IGL03013:Nlrp9b	APN	7	20048825	missense	probably damaging	1.00
R0037:Nlrp9b	UTSW	7	20023722	missense	probably damaging	0.99
R0114:Nlrp9b	UTSW	7	20024056	missense	probably benign	0.00
R0276:Nlrp9b	UTSW	7	20028498	missense	probably benign	0.21
R0346:Nlrp9b	UTSW	7	20024515	missense	probably damaging	0.99
R1449:Nlrp9b	UTSW	7	20023164	missense	possibly damaging	0.91
R1540:Nlrp9b	UTSW	7	20048847	nonsense	probably null
R1648:Nlrp9b	UTSW	7	20026544	missense	possibly damaging	0.89
R1878:Nlrp9b	UTSW	7	20028564	missense	probably benign	0.01
R1903:Nlrp9b	UTSW	7	20023257	missense	probably benign	0.44
R2191:Nlrp9b	UTSW	7	20023662	missense	probably benign
R4572:Nlrp9b	UTSW	7	20026681	critical splice donor site	probably null
R4863:Nlrp9b	UTSW	7	20049596	critical splice donor site	probably null
R4939:Nlrp9b	UTSW	7	20024496	missense	probably damaging	0.99
R5211:Nlrp9b	UTSW	7	20049456	missense	probably damaging	1.00
R5329:Nlrp9b	UTSW	7	20023991	missense	probably damaging	1.00
R5580:Nlrp9b	UTSW	7	20023164	missense	probably damaging	0.98
R5696:Nlrp9b	UTSW	7	20024492	missense	probably benign	0.02
R6265:Nlrp9b	UTSW	7	20062683	missense	probably benign
R6456:Nlrp9b	UTSW	7	20048778	missense	probably damaging	1.00
R6672:Nlrp9b	UTSW	7	20019338	missense	probably damaging	1.00
R6750:Nlrp9b	UTSW	7	20023234	nonsense	probably null
R6896:Nlrp9b	UTSW	7	20023245	missense	probably damaging	0.96
R6968:Nlrp9b	UTSW	7	20049508	missense	probably damaging	1.00
R7108:Nlrp9b	UTSW	7	20045930	missense	probably damaging	1.00
R7287:Nlrp9b	UTSW	7	20028456	missense	probably damaging	0.97
R7297:Nlrp9b	UTSW	7	20049513	missense	possibly damaging	0.81
R7485:Nlrp9b	UTSW	7	20023950	missense	probably damaging	1.00
R7552:Nlrp9b	UTSW	7	20045766	missense	probably benign	0.04
R7573:Nlrp9b	UTSW	7	20019200	missense	probably damaging	1.00
R7690:Nlrp9b	UTSW	7	20024370	missense	probably benign	0.00
X0064:Nlrp9b	UTSW	7	20048758	missense	probably damaging	1.00
Z1088:Nlrp9b	UTSW	7	20023743	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GGGGTCACAAATCCCTTTTGCTCTG -3'
(R):5'- TCAATGTCCTACAGTGCAGCAGTG -3'

Sequencing Primer
(F):5'- GCTCTGAAACAAGGATTTGCTC -3'
(R):5'- GGTTTGACCTTGAGCAAACTGAC -3'

Posted On

2013-09-03