Mutagenetix > Incidental Mutations

Incidental Mutation 'R8819:Rimbp3'

672948

Institutional Source

Beutler Lab

Gene Symbol

Rimbp3

Ensembl Gene

ENSMUSG00000071636

Gene Name

RIMS binding protein 3

Synonyms

RIM-BP3, LOC239731, LOC385766

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R8819 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

17208603-17213982 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 17210907 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 732 (S732P)

Ref Sequence

ENSEMBL: ENSMUSP00000127909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169803]

AlphaFold

Q3V0F0

Predicted Effect

probably benign
Transcript: ENSMUST00000169803
AA Change: S732P

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000127909
Gene: ENSMUSG00000071636
AA Change: S732P

Domain	Start	End	E-Value	Type
coiled coil region	25	56	N/A	INTRINSIC
coiled coil region	84	145	N/A	INTRINSIC
low complexity region	308	324	N/A	INTRINSIC
coiled coil region	395	431	N/A	INTRINSIC
coiled coil region	547	610	N/A	INTRINSIC
low complexity region	688	701	N/A	INTRINSIC
low complexity region	769	780	N/A	INTRINSIC
SH3	825	888	7.58e-8	SMART
low complexity region	913	924	N/A	INTRINSIC
FN3	980	1052	2.21e-3	SMART
FN3	1073	1160	1.91e1	SMART
low complexity region	1236	1243	N/A	INTRINSIC
SH3	1423	1487	5.08e-2	SMART
SH3	1539	1602	5.97e-6	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (52/52)

MGI Phenotype

PHENOTYPE: Male mice homozygous for a null mutation display infertility with impaired spermiogenesis and defects in sperm head and flagellum morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,726,454	F873L	possibly damaging	Het
4930504O13Rik	T	G	11: 58,446,303	S115R	probably damaging	Het
Abca17	A	G	17: 24,328,602	L266P	probably damaging	Het
Als2cl	T	C	9: 110,885,787	F125L	probably benign	Het
Arhgap33	T	C	7: 30,528,740	I406V	probably benign	Het
Bag5	T	C	12: 111,711,275	N38S	probably benign	Het
C530008M17Rik	CTGAGGCAGCGCGAGGCCGAGAGGCAGGAGGAGGAAG	C	5: 76,856,946		probably benign	Het
Clk2	T	A	3: 89,175,423	M392K	probably damaging	Het
Cngb1	C	T	8: 95,253,409		probably null	Het
Cps1	T	A	1: 67,228,280	N1402K	possibly damaging	Het
Cyp2u1	T	C	3: 131,298,367	H168R	probably damaging	Het
Dapl1	T	C	2: 59,504,712	L70P	probably damaging	Het
Ddr2	T	A	1: 169,977,914	K836*	probably null	Het
Dnmbp	C	T	19: 43,901,415	V638M	probably benign	Het
Dsel	A	G	1: 111,860,264	L847P	probably benign	Het
Eef1b2	T	C	1: 63,178,109		probably benign	Het
Fbll1	T	C	11: 35,797,975	K154E	probably benign	Het
Fbxw17	A	T	13: 50,433,315	K437M	possibly damaging	Het
Fktn	T	C	4: 53,735,001	V174A	possibly damaging	Het
Frem1	C	A	4: 82,903,517	S2118I	probably damaging	Het
Gabrb3	T	C	7: 57,792,581	S212P	probably damaging	Het
Gimap9	A	G	6: 48,677,887	D136G	probably benign	Het
Gm8300	C	T	12: 87,517,140	R82*	probably null	Het
Hps1	T	C	19: 42,771,209	I55V	probably benign	Het
Huwe1	A	G	X: 151,886,997	K1482R	probably benign	Het
Ift46	C	T	9: 44,790,522	T283I	probably damaging	Het
Ldb2	G	A	5: 44,799,415	Q27*	probably null	Het
Lmcd1	T	A	6: 112,329,809	I314N	probably damaging	Het
Mctp2	C	A	7: 72,229,333	V259L	probably benign	Het
Midn	T	G	10: 80,154,400	S302A	probably damaging	Het
Ncor2	A	G	5: 125,029,227	V797A		Het
Npm2	A	G	14: 70,648,328	S146P	probably damaging	Het
Npr1	G	A	3: 90,464,894	R204C	probably damaging	Het
Olfr1364	G	A	13: 21,573,829	S209L	probably benign	Het
Olfr49	C	T	14: 54,282,613	G94D	probably benign	Het
Olfr665	T	A	7: 104,881,655	V316D	possibly damaging	Het
Paip2b	A	C	6: 83,814,756	M48R	probably damaging	Het
Pcsk2	T	A	2: 143,801,070	H422Q	probably damaging	Het
Pdzph1	G	C	17: 58,880,720	Y1168*	probably null	Het
Peli2	G	A	14: 48,252,673	E201K	possibly damaging	Het
Prelp	T	C	1: 133,915,140	N89S	probably damaging	Het
Rapgef3	T	C	15: 97,748,657	N799S	probably benign	Het
Rel	C	T	11: 23,745,626	R219H	probably damaging	Het
Rock1	A	G	18: 10,070,626	F1196S	probably damaging	Het
Ryr3	G	A	2: 112,635,792	R4795W	probably damaging	Het
Ryr3	A	G	2: 112,859,724	V1180A	probably benign	Het
Scn11a	T	C	9: 119,816,520	I123V	probably benign	Het
Sema4b	G	C	7: 80,220,500	E475D	probably damaging	Het
Serinc2	C	A	4: 130,255,379	M343I	probably damaging	Het
Serinc5	G	T	13: 92,708,036	V429F	probably benign	Het
Tnfsf10	G	A	3: 27,335,302	V171M	probably benign	Het
Zfp27	T	C	7: 29,894,588	K651E	probably benign	Het
Zfp438	A	G	18: 5,213,383	I525T	possibly damaging	Het

Other mutations in Rimbp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Rimbp3	APN	16	17209743	missense	probably benign	0.01
IGL00786:Rimbp3	APN	16	17211688	missense	probably damaging	0.99
IGL01411:Rimbp3	APN	16	17211094	missense	probably damaging	1.00
IGL01434:Rimbp3	APN	16	17211702	missense	probably benign	0.13
IGL01895:Rimbp3	APN	16	17211436	missense	probably damaging	0.99
IGL02322:Rimbp3	APN	16	17211615	missense	probably benign	0.00
IGL02649:Rimbp3	APN	16	17209608	nonsense	probably null
IGL03285:Rimbp3	APN	16	17213232	missense	probably benign	0.16
PIT4581001:Rimbp3	UTSW	16	17210716	missense	possibly damaging	0.76
R0279:Rimbp3	UTSW	16	17209453	missense	probably benign	0.00
R0465:Rimbp3	UTSW	16	17211780	missense	possibly damaging	0.86
R0605:Rimbp3	UTSW	16	17211699	missense	probably damaging	0.99
R0674:Rimbp3	UTSW	16	17212737	missense	probably benign	0.02
R1676:Rimbp3	UTSW	16	17211113	missense	probably benign	0.13
R1780:Rimbp3	UTSW	16	17212632	missense	probably benign
R1946:Rimbp3	UTSW	16	17210427	missense	probably benign	0.10
R2113:Rimbp3	UTSW	16	17209675	missense	probably benign	0.00
R3847:Rimbp3	UTSW	16	17210299	missense	probably benign	0.13
R3849:Rimbp3	UTSW	16	17210299	missense	probably benign	0.13
R3850:Rimbp3	UTSW	16	17210299	missense	probably benign	0.13
R4355:Rimbp3	UTSW	16	17209692	missense	possibly damaging	0.56
R4646:Rimbp3	UTSW	16	17213098	missense	probably damaging	0.99
R4669:Rimbp3	UTSW	16	17209189	missense	possibly damaging	0.88
R4732:Rimbp3	UTSW	16	17210601	missense	possibly damaging	0.94
R4733:Rimbp3	UTSW	16	17210601	missense	possibly damaging	0.94
R5025:Rimbp3	UTSW	16	17209807	missense	probably damaging	0.99
R5039:Rimbp3	UTSW	16	17213331	missense	probably damaging	0.99
R5177:Rimbp3	UTSW	16	17209917	missense	possibly damaging	0.85
R5311:Rimbp3	UTSW	16	17210844	missense	probably benign	0.00
R5942:Rimbp3	UTSW	16	17211888	missense	probably benign	0.00
R6063:Rimbp3	UTSW	16	17210917	missense	probably damaging	1.00
R6092:Rimbp3	UTSW	16	17212270	missense	probably damaging	1.00
R6126:Rimbp3	UTSW	16	17212276	missense	probably benign	0.25
R6288:Rimbp3	UTSW	16	17212908	missense	probably benign	0.22
R6446:Rimbp3	UTSW	16	17212929	missense	probably benign	0.00
R6773:Rimbp3	UTSW	16	17209015	missense	probably damaging	1.00
R7017:Rimbp3	UTSW	16	17209746	missense	probably benign	0.04
R7043:Rimbp3	UTSW	16	17211108	missense	probably damaging	1.00
R7048:Rimbp3	UTSW	16	17210326	missense	probably benign	0.20
R7378:Rimbp3	UTSW	16	17211204	missense	probably benign
R7440:Rimbp3	UTSW	16	17213201	missense	possibly damaging	0.78
R7788:Rimbp3	UTSW	16	17212704	missense	probably benign	0.00
R7879:Rimbp3	UTSW	16	17211046	missense	possibly damaging	0.71
R8071:Rimbp3	UTSW	16	17210863	missense	probably benign
R8272:Rimbp3	UTSW	16	17209105	missense	possibly damaging	0.85
R8419:Rimbp3	UTSW	16	17213022	missense	probably damaging	0.97
R8830:Rimbp3	UTSW	16	17209006	missense	probably damaging	0.98
R8936:Rimbp3	UTSW	16	17213020	missense	probably benign
R8982:Rimbp3	UTSW	16	17209647	missense	probably benign	0.11
R9365:Rimbp3	UTSW	16	17208756	missense	possibly damaging	0.93
Z1176:Rimbp3	UTSW	16	17209474	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- AGCAGCTGCAGCACTACAAG -3'
(R):5'- GCTGTGTCCATGTCCAAAGAAAG -3'

Sequencing Primer
(F):5'- CTAAGTGACCTTAGGACTTCCGG -3'
(R):5'- TGTCCATGTCCAAAGAAAGGCAAG -3'

Posted On

2021-04-30