Incidental Mutation 'R8820:Scn11a'
ID 672993
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Name sodium channel, voltage-gated, type XI, alpha
Synonyms NaN, NSS2, NaT, SNS2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock # R8820 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 119753759-119825456 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119816520 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 123 (I123V)
Ref Sequence ENSEMBL: ENSMUSP00000065466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
AlphaFold Q9R053
Predicted Effect probably benign
Transcript: ENSMUST00000070617
AA Change: I123V

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: I123V

low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215718
AA Change: I123V

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,726,454 F873L possibly damaging Het
4930504O13Rik T G 11: 58,446,303 S115R probably damaging Het
Abca17 A G 17: 24,328,602 L266P probably damaging Het
Abcb1a A T 5: 8,723,204 T811S possibly damaging Het
Als2cl T C 9: 110,885,787 F125L probably benign Het
Arhgap33 T C 7: 30,528,740 I406V probably benign Het
Cdyl T C 13: 35,858,191 I404T probably damaging Het
Clasrp C T 7: 19,586,437 R432H unknown Het
Clk2 T A 3: 89,175,423 M392K probably damaging Het
Cps1 T A 1: 67,228,280 N1402K possibly damaging Het
Cyp2u1 T C 3: 131,298,367 H168R probably damaging Het
Dapl1 T C 2: 59,504,712 L70P probably damaging Het
Ddr2 T A 1: 169,977,914 K836* probably null Het
Dsel A G 1: 111,860,264 L847P probably benign Het
Fbxw17 A T 13: 50,433,315 K437M possibly damaging Het
Fktn T C 4: 53,735,001 V174A possibly damaging Het
Frem1 C A 4: 82,903,517 S2118I probably damaging Het
Fzd8 G A 18: 9,213,247 V110M unknown Het
Gabrb3 T C 7: 57,792,581 S212P probably damaging Het
Gimap9 A G 6: 48,677,887 D136G probably benign Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ift46 C T 9: 44,790,522 T283I probably damaging Het
Il1f8 C T 2: 24,159,880 Q168* probably null Het
Ldb2 G A 5: 44,799,415 Q27* probably null Het
Lmcd1 T A 6: 112,329,809 I314N probably damaging Het
Mctp2 C A 7: 72,229,333 V259L probably benign Het
Midn T G 10: 80,154,400 S302A probably damaging Het
Ncor2 A G 5: 125,029,227 V797A Het
Npm2 A G 14: 70,648,328 S146P probably damaging Het
Npr1 G A 3: 90,464,894 R204C probably damaging Het
Olfr338 T C 2: 36,376,994 S73P probably damaging Het
Olfr353 C A 2: 36,890,610 M79I probably benign Het
Olfr49 C T 14: 54,282,613 G94D probably benign Het
Olfr665 T A 7: 104,881,655 V316D possibly damaging Het
Orc2 T C 1: 58,476,480 N290D probably benign Het
Paip2b A C 6: 83,814,756 M48R probably damaging Het
Pcdhb15 T A 18: 37,473,918 S68T probably benign Het
Pcnx T A 12: 81,973,248 H715Q Het
Pcsk2 T A 2: 143,801,070 H422Q probably damaging Het
Pdzph1 G C 17: 58,880,720 Y1168* probably null Het
Peli2 G A 14: 48,252,673 E201K possibly damaging Het
Prelp T C 1: 133,915,140 N89S probably damaging Het
Proz T A 8: 13,063,253 F25I probably damaging Het
Rapgef3 T C 15: 97,748,657 N799S probably benign Het
Ryr3 A G 2: 112,859,724 V1180A probably benign Het
Ryr3 G A 2: 112,635,792 R4795W probably damaging Het
Sema4b G C 7: 80,220,500 E475D probably damaging Het
Serinc2 C A 4: 130,255,379 M343I probably damaging Het
Serinc5 G T 13: 92,708,036 V429F probably benign Het
Smyd2 T A 1: 189,899,821 K115N probably benign Het
Tenm3 T G 8: 48,310,724 D765A probably damaging Het
Tmem2 G A 19: 21,807,454 V434M probably damaging Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Ythdc2 C T 18: 44,834,464 R176* probably null Het
Zfp27 T C 7: 29,894,588 K651E probably benign Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119770506 missense probably benign 0.00
IGL00272:Scn11a APN 9 119816603 missense probably damaging 0.98
IGL00332:Scn11a APN 9 119769916 missense probably damaging 1.00
IGL00533:Scn11a APN 9 119774381 missense probably damaging 1.00
IGL00972:Scn11a APN 9 119793938 missense probably benign 0.44
IGL01338:Scn11a APN 9 119784161 splice site probably benign
IGL01534:Scn11a APN 9 119780822 missense probably benign 0.27
IGL01838:Scn11a APN 9 119758583 missense probably damaging 1.00
IGL01991:Scn11a APN 9 119819904 missense probably damaging 0.97
IGL02057:Scn11a APN 9 119765470 missense probably damaging 1.00
IGL02290:Scn11a APN 9 119774442 missense probably damaging 0.97
IGL02454:Scn11a APN 9 119758544 missense probably benign 0.00
IGL02517:Scn11a APN 9 119792398 missense probably damaging 1.00
IGL02567:Scn11a APN 9 119804489 missense probably damaging 0.99
IGL02587:Scn11a APN 9 119805684 missense probably damaging 1.00
IGL03069:Scn11a APN 9 119789963 missense probably benign 0.16
IGL03171:Scn11a APN 9 119819847 missense probably benign 0.00
Kleinie UTSW 9 119803503 missense probably benign 0.16
H8441:Scn11a UTSW 9 119807910 missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119769948 missense probably damaging 1.00
R0304:Scn11a UTSW 9 119819862 missense probably benign 0.00
R0519:Scn11a UTSW 9 119790119 missense probably damaging 1.00
R0658:Scn11a UTSW 9 119811160 missense probably benign 0.41
R0828:Scn11a UTSW 9 119755007 missense probably benign 0.00
R0893:Scn11a UTSW 9 119803330 splice site probably null
R0932:Scn11a UTSW 9 119807810 missense probably damaging 1.00
R1061:Scn11a UTSW 9 119795663 missense probably damaging 0.98
R1161:Scn11a UTSW 9 119755057 nonsense probably null
R1162:Scn11a UTSW 9 119805644 splice site probably benign
R1310:Scn11a UTSW 9 119755057 nonsense probably null
R1589:Scn11a UTSW 9 119769807 missense probably damaging 1.00
R1681:Scn11a UTSW 9 119804412 missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119755082 missense probably damaging 1.00
R1812:Scn11a UTSW 9 119780865 nonsense probably null
R1901:Scn11a UTSW 9 119779036 nonsense probably null
R1978:Scn11a UTSW 9 119780795 nonsense probably null
R1985:Scn11a UTSW 9 119754678 missense probably benign 0.19
R2022:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119792494 missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119755025 missense probably damaging 1.00
R2250:Scn11a UTSW 9 119758602 missense probably benign 0.01
R2373:Scn11a UTSW 9 119813186 missense probably benign 0.43
R2508:Scn11a UTSW 9 119765529 missense probably damaging 1.00
R3757:Scn11a UTSW 9 119803503 missense probably benign 0.16
R3767:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R3770:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R4089:Scn11a UTSW 9 119795653 splice site probably null
R4092:Scn11a UTSW 9 119789970 missense probably benign 0.03
R4247:Scn11a UTSW 9 119807886 missense probably damaging 1.00
R4279:Scn11a UTSW 9 119754362 missense probably benign 0.25
R4299:Scn11a UTSW 9 119765506 missense probably damaging 0.97
R4403:Scn11a UTSW 9 119795667 missense probably damaging 1.00
R4468:Scn11a UTSW 9 119754987 missense probably damaging 1.00
R4542:Scn11a UTSW 9 119755134 missense probably damaging 1.00
R4644:Scn11a UTSW 9 119815203 splice site probably null
R4739:Scn11a UTSW 9 119754561 missense probably benign 0.39
R4809:Scn11a UTSW 9 119819870 missense probably benign 0.00
R4954:Scn11a UTSW 9 119758659 missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119780878 missense probably benign 0.31
R5044:Scn11a UTSW 9 119819831 missense probably damaging 0.98
R5222:Scn11a UTSW 9 119815202 splice site probably null
R5224:Scn11a UTSW 9 119754792 missense probably damaging 1.00
R5400:Scn11a UTSW 9 119769908 missense probably damaging 0.97
R5555:Scn11a UTSW 9 119755238 missense probably damaging 1.00
R5711:Scn11a UTSW 9 119789924 missense probably damaging 1.00
R5950:Scn11a UTSW 9 119811124 missense probably damaging 1.00
R5984:Scn11a UTSW 9 119784016 missense probably benign
R6057:Scn11a UTSW 9 119765448 missense probably damaging 1.00
R6104:Scn11a UTSW 9 119795678 missense probably damaging 1.00
R6180:Scn11a UTSW 9 119754867 missense probably benign 0.00
R6892:Scn11a UTSW 9 119806969 missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119792426 missense probably damaging 1.00
R6949:Scn11a UTSW 9 119765514 missense probably benign 0.04
R7112:Scn11a UTSW 9 119754809 missense probably damaging 1.00
R7232:Scn11a UTSW 9 119759916 missense probably damaging 1.00
R7261:Scn11a UTSW 9 119819833 missense probably damaging 0.99
R7265:Scn11a UTSW 9 119815265 missense probably damaging 1.00
R7302:Scn11a UTSW 9 119806951 missense probably benign 0.03
R7391:Scn11a UTSW 9 119795717 missense probably damaging 1.00
R7441:Scn11a UTSW 9 119758626 missense probably benign 0.01
R7479:Scn11a UTSW 9 119759875 missense probably benign 0.38
R7608:Scn11a UTSW 9 119815313 splice site probably null
R7768:Scn11a UTSW 9 119815272 missense probably benign 0.13
R7785:Scn11a UTSW 9 119816556 missense probably benign 0.00
R7794:Scn11a UTSW 9 119765514 missense probably damaging 0.99
R7818:Scn11a UTSW 9 119784111 missense probably damaging 0.97
R7884:Scn11a UTSW 9 119804551 missense probably benign 0.01
R7988:Scn11a UTSW 9 119765437 missense probably damaging 0.97
R8049:Scn11a UTSW 9 119755083 missense probably damaging 1.00
R8127:Scn11a UTSW 9 119804512 missense probably damaging 1.00
R8274:Scn11a UTSW 9 119803482 missense probably benign
R8344:Scn11a UTSW 9 119781970 missense probably benign 0.00
R8346:Scn11a UTSW 9 119778981 missense probably damaging 1.00
R8511:Scn11a UTSW 9 119789915 missense probably damaging 0.99
R8819:Scn11a UTSW 9 119816520 missense probably benign 0.19
R8837:Scn11a UTSW 9 119792344 missense probably damaging 1.00
R8913:Scn11a UTSW 9 119794028 missense probably damaging 1.00
R8915:Scn11a UTSW 9 119774297 nonsense probably null
R8975:Scn11a UTSW 9 119758499 missense probably damaging 1.00
R9156:Scn11a UTSW 9 119759923 missense possibly damaging 0.75
R9222:Scn11a UTSW 9 119781947 missense probably damaging 0.98
R9355:Scn11a UTSW 9 119755094 missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119755242 missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119754998 missense possibly damaging 0.94
Z1177:Scn11a UTSW 9 119819820 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2021-04-30