Incidental Mutation 'R8820:Cdyl'
ID673000
Institutional Source Beutler Lab
Gene Symbol Cdyl
Ensembl Gene ENSMUSG00000059288
Gene Namechromodomain protein, Y chromosome-like
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock #R8820 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location35659833-35874063 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35858191 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 404 (I404T)
Ref Sequence ENSEMBL: ENSMUSP00000074707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075220] [ENSMUST00000163595]
Predicted Effect probably damaging
Transcript: ENSMUST00000075220
AA Change: I404T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074707
Gene: ENSMUSG00000059288
AA Change: I404T

DomainStartEndE-ValueType
CHROMO 55 109 2.06e-18 SMART
low complexity region 116 129 N/A INTRINSIC
Pfam:ECH_1 342 593 1.8e-35 PFAM
Pfam:ECH_2 348 592 6e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163595
AA Change: I355T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131784
Gene: ENSMUSG00000059288
AA Change: I355T

DomainStartEndE-ValueType
CHROMO 6 60 1.58e-19 SMART
low complexity region 67 80 N/A INTRINSIC
Pfam:ECH 291 539 4e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chromodomain Y is a primate-specific Y-chromosomal gene family expressed exclusively in the testis and implicated in infertility. Although the Y-linked genes are testis-specific, this autosomal gene is ubiquitously expressed. The Y-linked genes arose by retrotransposition of an mRNA from this gene, followed by amplification of the retroposed gene. Proteins encoded by this gene superfamily possess a chromodomain, a motif implicated in chromatin binding and gene suppression, and a catalytic domain believed to be involved in histone acetylation. Multiple proteins are encoded by transcript variants of this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Conditional homozygous knockout in the cerebral cortex affects neuronal migration and results in increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,726,454 F873L possibly damaging Het
4930504O13Rik T G 11: 58,446,303 S115R probably damaging Het
Abca17 A G 17: 24,328,602 L266P probably damaging Het
Abcb1a A T 5: 8,723,204 T811S possibly damaging Het
Als2cl T C 9: 110,885,787 F125L probably benign Het
Arhgap33 T C 7: 30,528,740 I406V probably benign Het
Clasrp C T 7: 19,586,437 R432H unknown Het
Clk2 T A 3: 89,175,423 M392K probably damaging Het
Cps1 T A 1: 67,228,280 N1402K possibly damaging Het
Cyp2u1 T C 3: 131,298,367 H168R probably damaging Het
Dapl1 T C 2: 59,504,712 L70P probably damaging Het
Ddr2 T A 1: 169,977,914 K836* probably null Het
Dsel A G 1: 111,860,264 L847P probably benign Het
Fbxw17 A T 13: 50,433,315 K437M possibly damaging Het
Fktn T C 4: 53,735,001 V174A possibly damaging Het
Frem1 C A 4: 82,903,517 S2118I probably damaging Het
Fzd8 G A 18: 9,213,247 V110M unknown Het
Gabrb3 T C 7: 57,792,581 S212P probably damaging Het
Gimap9 A G 6: 48,677,887 D136G probably benign Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ift46 C T 9: 44,790,522 T283I probably damaging Het
Il1f8 C T 2: 24,159,880 Q168* probably null Het
Ldb2 G A 5: 44,799,415 Q27* probably null Het
Lmcd1 T A 6: 112,329,809 I314N probably damaging Het
Mctp2 C A 7: 72,229,333 V259L probably benign Het
Midn T G 10: 80,154,400 S302A probably damaging Het
Ncor2 A G 5: 125,029,227 V797A Het
Npm2 A G 14: 70,648,328 S146P probably damaging Het
Npr1 G A 3: 90,464,894 R204C probably damaging Het
Olfr338 T C 2: 36,376,994 S73P probably damaging Het
Olfr353 C A 2: 36,890,610 M79I probably benign Het
Olfr49 C T 14: 54,282,613 G94D probably benign Het
Olfr665 T A 7: 104,881,655 V316D possibly damaging Het
Orc2 T C 1: 58,476,480 N290D probably benign Het
Paip2b A C 6: 83,814,756 M48R probably damaging Het
Pcdhb15 T A 18: 37,473,918 S68T probably benign Het
Pcnx T A 12: 81,973,248 H715Q Het
Pcsk2 T A 2: 143,801,070 H422Q probably damaging Het
Pdzph1 G C 17: 58,880,720 Y1168* probably null Het
Peli2 G A 14: 48,252,673 E201K possibly damaging Het
Prelp T C 1: 133,915,140 N89S probably damaging Het
Proz T A 8: 13,063,253 F25I probably damaging Het
Rapgef3 T C 15: 97,748,657 N799S probably benign Het
Ryr3 A G 2: 112,859,724 V1180A probably benign Het
Ryr3 G A 2: 112,635,792 R4795W probably damaging Het
Scn11a T C 9: 119,816,520 I123V probably benign Het
Sema4b G C 7: 80,220,500 E475D probably damaging Het
Serinc2 C A 4: 130,255,379 M343I probably damaging Het
Serinc5 G T 13: 92,708,036 V429F probably benign Het
Smyd2 T A 1: 189,899,821 K115N probably benign Het
Tenm3 T G 8: 48,310,724 D765A probably damaging Het
Tmem2 G A 19: 21,807,454 V434M probably damaging Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Unc13d ATGCCTCCC ATGCCTCCCCTGCCTCCC 11: 116,068,173 probably benign Het
Ythdc2 C T 18: 44,834,464 R176* probably null Het
Zfp27 T C 7: 29,894,588 K651E probably benign Het
Other mutations in Cdyl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Cdyl APN 13 35816113 missense probably damaging 0.98
IGL01547:Cdyl APN 13 35790162 missense possibly damaging 0.90
IGL01911:Cdyl APN 13 35863243 missense probably damaging 0.97
IGL02584:Cdyl APN 13 35683786 missense probably benign
IGL02754:Cdyl APN 13 35683742 splice site probably benign
R1630:Cdyl UTSW 13 35683803 missense possibly damaging 0.66
R1678:Cdyl UTSW 13 35856889 missense probably damaging 0.99
R1802:Cdyl UTSW 13 35872636 nonsense probably null
R4435:Cdyl UTSW 13 35858250 critical splice donor site probably null
R5841:Cdyl UTSW 13 35872561 missense probably damaging 1.00
R5860:Cdyl UTSW 13 35858083 missense possibly damaging 0.73
R6430:Cdyl UTSW 13 35871606 missense possibly damaging 0.74
R7127:Cdyl UTSW 13 35856668 missense probably benign 0.01
R7296:Cdyl UTSW 13 35863395 missense probably damaging 1.00
R7369:Cdyl UTSW 13 35816009 missense probably damaging 1.00
R7422:Cdyl UTSW 13 35858194 missense possibly damaging 0.90
R7635:Cdyl UTSW 13 35871651 missense probably damaging 1.00
R7756:Cdyl UTSW 13 35872641 missense probably damaging 1.00
R7758:Cdyl UTSW 13 35872641 missense probably damaging 1.00
R7764:Cdyl UTSW 13 35816143 missense possibly damaging 0.92
R8221:Cdyl UTSW 13 35816164 missense probably benign 0.00
Z1176:Cdyl UTSW 13 35815966 missense probably damaging 1.00
Z1177:Cdyl UTSW 13 35816070 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GAGGTGGCGTTGATCTTAGACC -3'
(R):5'- AGTCTTGCTACAGTGCCTTTCAG -3'

Sequencing Primer
(F):5'- GGCGTTGATCTTAGACCTAGAC -3'
(R):5'- GAGGACGATGTACACTTTCCTCAAG -3'
Posted On2021-04-30