Incidental Mutation 'R8820:Rapgef3'
ID 673006
Institutional Source Beutler Lab
Gene Symbol Rapgef3
Ensembl Gene ENSMUSG00000022469
Gene Name Rap guanine nucleotide exchange factor (GEF) 3
Synonyms 2310016P22Rik, 9330170P05Rik, Epac1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.197) question?
Stock # R8820 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 97744770-97767972 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 97748657 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 799 (N799S)
Ref Sequence ENSEMBL: ENSMUSP00000116426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126854] [ENSMUST00000128775] [ENSMUST00000129223] [ENSMUST00000134885] [ENSMUST00000175894] [ENSMUST00000177352]
AlphaFold Q8VCC8
Predicted Effect probably benign
Transcript: ENSMUST00000126854
AA Change: N799S

PolyPhen 2 Score 0.386 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116426
Gene: ENSMUSG00000022469
AA Change: N799S

DomainStartEndE-ValueType
DEP 111 186 2.05e-25 SMART
low complexity region 197 208 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
cNMP 245 364 2.53e-12 SMART
RasGEFN 383 514 7.04e-10 SMART
Blast:RasGEF 547 644 6e-45 BLAST
RasGEF 661 926 7.98e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128775
AA Change: N782S

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120126
Gene: ENSMUSG00000022469
AA Change: N782S

DomainStartEndE-ValueType
DEP 111 186 2.05e-25 SMART
low complexity region 197 208 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
cNMP 245 364 2.53e-12 SMART
RasGEFN 383 514 7.04e-10 SMART
Blast:RasGEF 547 644 7e-45 BLAST
RasGEF 661 909 5.53e-80 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000129223
AA Change: N791S

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118148
Gene: ENSMUSG00000022469
AA Change: N791S

DomainStartEndE-ValueType
DEP 111 186 2.05e-25 SMART
low complexity region 197 208 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
cNMP 245 364 2.53e-12 SMART
RasGEFN 383 514 7.04e-10 SMART
Blast:RasGEF 547 644 6e-45 BLAST
RasGEF 661 918 2.11e-85 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000134885
AA Change: N89S

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135317
Gene: ENSMUSG00000022469
AA Change: N89S

DomainStartEndE-ValueType
RasGEF 1 216 2.91e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175894
Predicted Effect probably benign
Transcript: ENSMUST00000177352
AA Change: N757S

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135238
Gene: ENSMUSG00000022469
AA Change: N757S

DomainStartEndE-ValueType
DEP 69 144 2.05e-25 SMART
low complexity region 155 166 N/A INTRINSIC
low complexity region 188 199 N/A INTRINSIC
cNMP 203 322 2.53e-12 SMART
RasGEFN 341 472 7.04e-10 SMART
Blast:RasGEF 505 602 3e-45 BLAST
RasGEF 619 884 7.98e-95 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased induced neuron apoptosis. Mice homozygous for a different allele exhibit impaired glucose homeostasis with decreased insulin secretion, increased susceptibility to diet-induced obesity and streptozotocin-induced insulitis and hyperglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,726,454 F873L possibly damaging Het
4930504O13Rik T G 11: 58,446,303 S115R probably damaging Het
Abca17 A G 17: 24,328,602 L266P probably damaging Het
Abcb1a A T 5: 8,723,204 T811S possibly damaging Het
Als2cl T C 9: 110,885,787 F125L probably benign Het
Arhgap33 T C 7: 30,528,740 I406V probably benign Het
Cdyl T C 13: 35,858,191 I404T probably damaging Het
Clasrp C T 7: 19,586,437 R432H unknown Het
Clk2 T A 3: 89,175,423 M392K probably damaging Het
Cps1 T A 1: 67,228,280 N1402K possibly damaging Het
Cyp2u1 T C 3: 131,298,367 H168R probably damaging Het
Dapl1 T C 2: 59,504,712 L70P probably damaging Het
Ddr2 T A 1: 169,977,914 K836* probably null Het
Dsel A G 1: 111,860,264 L847P probably benign Het
Fbxw17 A T 13: 50,433,315 K437M possibly damaging Het
Fktn T C 4: 53,735,001 V174A possibly damaging Het
Frem1 C A 4: 82,903,517 S2118I probably damaging Het
Fzd8 G A 18: 9,213,247 V110M unknown Het
Gabrb3 T C 7: 57,792,581 S212P probably damaging Het
Gimap9 A G 6: 48,677,887 D136G probably benign Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ift46 C T 9: 44,790,522 T283I probably damaging Het
Il1f8 C T 2: 24,159,880 Q168* probably null Het
Ldb2 G A 5: 44,799,415 Q27* probably null Het
Lmcd1 T A 6: 112,329,809 I314N probably damaging Het
Mctp2 C A 7: 72,229,333 V259L probably benign Het
Midn T G 10: 80,154,400 S302A probably damaging Het
Ncor2 A G 5: 125,029,227 V797A Het
Npm2 A G 14: 70,648,328 S146P probably damaging Het
Npr1 G A 3: 90,464,894 R204C probably damaging Het
Olfr338 T C 2: 36,376,994 S73P probably damaging Het
Olfr353 C A 2: 36,890,610 M79I probably benign Het
Olfr49 C T 14: 54,282,613 G94D probably benign Het
Olfr665 T A 7: 104,881,655 V316D possibly damaging Het
Orc2 T C 1: 58,476,480 N290D probably benign Het
Paip2b A C 6: 83,814,756 M48R probably damaging Het
Pcdhb15 T A 18: 37,473,918 S68T probably benign Het
Pcnx T A 12: 81,973,248 H715Q Het
Pcsk2 T A 2: 143,801,070 H422Q probably damaging Het
Pdzph1 G C 17: 58,880,720 Y1168* probably null Het
Peli2 G A 14: 48,252,673 E201K possibly damaging Het
Prelp T C 1: 133,915,140 N89S probably damaging Het
Proz T A 8: 13,063,253 F25I probably damaging Het
Ryr3 G A 2: 112,635,792 R4795W probably damaging Het
Ryr3 A G 2: 112,859,724 V1180A probably benign Het
Scn11a T C 9: 119,816,520 I123V probably benign Het
Sema4b G C 7: 80,220,500 E475D probably damaging Het
Serinc2 C A 4: 130,255,379 M343I probably damaging Het
Serinc5 G T 13: 92,708,036 V429F probably benign Het
Smyd2 T A 1: 189,899,821 K115N probably benign Het
Tenm3 T G 8: 48,310,724 D765A probably damaging Het
Tmem2 G A 19: 21,807,454 V434M probably damaging Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Ythdc2 C T 18: 44,834,464 R176* probably null Het
Zfp27 T C 7: 29,894,588 K651E probably benign Het
Other mutations in Rapgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Rapgef3 APN 15 97748223 missense probably damaging 1.00
IGL01339:Rapgef3 APN 15 97758059 missense probably damaging 1.00
IGL01670:Rapgef3 APN 15 97749662 missense probably benign 0.15
IGL01902:Rapgef3 APN 15 97750300 missense probably benign 0.32
IGL02137:Rapgef3 APN 15 97750144 missense probably benign 0.08
IGL02419:Rapgef3 APN 15 97750290 missense probably benign 0.33
IGL02427:Rapgef3 APN 15 97747136 splice site probably null
IGL02648:Rapgef3 APN 15 97758392 missense probably damaging 1.00
IGL02834:Rapgef3 APN 15 97748265 missense probably damaging 0.98
IGL03389:Rapgef3 APN 15 97749516 missense probably damaging 1.00
IGL03055:Rapgef3 UTSW 15 97749489 splice site probably benign
R0394:Rapgef3 UTSW 15 97757819 intron probably benign
R0538:Rapgef3 UTSW 15 97757817 intron probably benign
R0744:Rapgef3 UTSW 15 97761585 splice site probably benign
R1288:Rapgef3 UTSW 15 97759342 missense probably benign 0.31
R1512:Rapgef3 UTSW 15 97757501 missense probably benign 0.24
R1676:Rapgef3 UTSW 15 97761182 missense probably benign 0.35
R1745:Rapgef3 UTSW 15 97750178 missense probably benign 0.22
R1928:Rapgef3 UTSW 15 97750033 missense probably damaging 1.00
R2063:Rapgef3 UTSW 15 97766961 missense probably damaging 1.00
R2067:Rapgef3 UTSW 15 97766961 missense probably damaging 1.00
R2092:Rapgef3 UTSW 15 97760723 missense probably damaging 1.00
R4358:Rapgef3 UTSW 15 97748648 missense probably benign 0.05
R4624:Rapgef3 UTSW 15 97758929 missense probably damaging 1.00
R4627:Rapgef3 UTSW 15 97758929 missense probably damaging 1.00
R4727:Rapgef3 UTSW 15 97760600 missense probably damaging 1.00
R4812:Rapgef3 UTSW 15 97753803 missense probably benign 0.21
R4928:Rapgef3 UTSW 15 97757375 missense probably damaging 1.00
R5161:Rapgef3 UTSW 15 97757725 missense probably damaging 1.00
R5442:Rapgef3 UTSW 15 97758861 missense probably damaging 0.99
R5652:Rapgef3 UTSW 15 97758437 missense probably benign 0.00
R5837:Rapgef3 UTSW 15 97757342 splice site probably benign
R6056:Rapgef3 UTSW 15 97758861 missense probably damaging 0.99
R6167:Rapgef3 UTSW 15 97767411 unclassified probably benign
R6694:Rapgef3 UTSW 15 97759984 missense probably benign 0.03
R7039:Rapgef3 UTSW 15 97761568 missense probably benign 0.01
R7154:Rapgef3 UTSW 15 97753877 missense probably benign
R7380:Rapgef3 UTSW 15 97766791 missense probably benign 0.00
R7655:Rapgef3 UTSW 15 97761209 missense probably damaging 1.00
R7656:Rapgef3 UTSW 15 97761209 missense probably damaging 1.00
R7754:Rapgef3 UTSW 15 97757746 missense probably damaging 1.00
R7849:Rapgef3 UTSW 15 97758390 critical splice donor site probably null
R8061:Rapgef3 UTSW 15 97761520 missense probably benign
R8117:Rapgef3 UTSW 15 97750866 missense probably benign 0.01
R8179:Rapgef3 UTSW 15 97760740 missense probably benign 0.06
R8819:Rapgef3 UTSW 15 97748657 missense probably benign 0.39
R8824:Rapgef3 UTSW 15 97766908 missense probably benign 0.39
R9779:Rapgef3 UTSW 15 97745598 missense probably damaging 0.99
R9781:Rapgef3 UTSW 15 97745598 missense probably damaging 0.99
R9782:Rapgef3 UTSW 15 97745598 missense probably damaging 0.99
RF024:Rapgef3 UTSW 15 97760740 missense probably benign 0.06
X0011:Rapgef3 UTSW 15 97761473 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGTATCTCCTGGGGTATCTACC -3'
(R):5'- ACTTAGAAAGCCAGGCCTCAG -3'

Sequencing Primer
(F):5'- GGTATCTACCACAGCCTCGG -3'
(R):5'- CCAGGCCTCAGTGCTGTTTG -3'
Posted On 2021-04-30