Incidental Mutation 'R8820:Abca17'
ID 673007
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene Name ATP-binding cassette, sub-family A (ABC1), member 17
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8820 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 24264259-24351029 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24328602 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 266 (L266P)
Ref Sequence ENSEMBL: ENSMUSP00000046218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
AlphaFold E9PX95
Predicted Effect probably damaging
Transcript: ENSMUST00000039324
AA Change: L266P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: L266P

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121226
AA Change: L266P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: L266P

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,726,454 F873L possibly damaging Het
4930504O13Rik T G 11: 58,446,303 S115R probably damaging Het
Abcb1a A T 5: 8,723,204 T811S possibly damaging Het
Als2cl T C 9: 110,885,787 F125L probably benign Het
Arhgap33 T C 7: 30,528,740 I406V probably benign Het
Cdyl T C 13: 35,858,191 I404T probably damaging Het
Clasrp C T 7: 19,586,437 R432H unknown Het
Clk2 T A 3: 89,175,423 M392K probably damaging Het
Cps1 T A 1: 67,228,280 N1402K possibly damaging Het
Cyp2u1 T C 3: 131,298,367 H168R probably damaging Het
Dapl1 T C 2: 59,504,712 L70P probably damaging Het
Ddr2 T A 1: 169,977,914 K836* probably null Het
Dsel A G 1: 111,860,264 L847P probably benign Het
Fbxw17 A T 13: 50,433,315 K437M possibly damaging Het
Fktn T C 4: 53,735,001 V174A possibly damaging Het
Frem1 C A 4: 82,903,517 S2118I probably damaging Het
Fzd8 G A 18: 9,213,247 V110M unknown Het
Gabrb3 T C 7: 57,792,581 S212P probably damaging Het
Gimap9 A G 6: 48,677,887 D136G probably benign Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ift46 C T 9: 44,790,522 T283I probably damaging Het
Il1f8 C T 2: 24,159,880 Q168* probably null Het
Ldb2 G A 5: 44,799,415 Q27* probably null Het
Lmcd1 T A 6: 112,329,809 I314N probably damaging Het
Mctp2 C A 7: 72,229,333 V259L probably benign Het
Midn T G 10: 80,154,400 S302A probably damaging Het
Ncor2 A G 5: 125,029,227 V797A Het
Npm2 A G 14: 70,648,328 S146P probably damaging Het
Npr1 G A 3: 90,464,894 R204C probably damaging Het
Olfr338 T C 2: 36,376,994 S73P probably damaging Het
Olfr353 C A 2: 36,890,610 M79I probably benign Het
Olfr49 C T 14: 54,282,613 G94D probably benign Het
Olfr665 T A 7: 104,881,655 V316D possibly damaging Het
Orc2 T C 1: 58,476,480 N290D probably benign Het
Paip2b A C 6: 83,814,756 M48R probably damaging Het
Pcdhb15 T A 18: 37,473,918 S68T probably benign Het
Pcnx T A 12: 81,973,248 H715Q Het
Pcsk2 T A 2: 143,801,070 H422Q probably damaging Het
Pdzph1 G C 17: 58,880,720 Y1168* probably null Het
Peli2 G A 14: 48,252,673 E201K possibly damaging Het
Prelp T C 1: 133,915,140 N89S probably damaging Het
Proz T A 8: 13,063,253 F25I probably damaging Het
Rapgef3 T C 15: 97,748,657 N799S probably benign Het
Ryr3 G A 2: 112,635,792 R4795W probably damaging Het
Ryr3 A G 2: 112,859,724 V1180A probably benign Het
Scn11a T C 9: 119,816,520 I123V probably benign Het
Sema4b G C 7: 80,220,500 E475D probably damaging Het
Serinc2 C A 4: 130,255,379 M343I probably damaging Het
Serinc5 G T 13: 92,708,036 V429F probably benign Het
Smyd2 T A 1: 189,899,821 K115N probably benign Het
Tenm3 T G 8: 48,310,724 D765A probably damaging Het
Tmem2 G A 19: 21,807,454 V434M probably damaging Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Ythdc2 C T 18: 44,834,464 R176* probably null Het
Zfp27 T C 7: 29,894,588 K651E probably benign Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24295191 missense probably benign 0.14
IGL00585:Abca17 APN 17 24300320 missense probably damaging 0.99
IGL00941:Abca17 APN 17 24317130 missense probably damaging 1.00
IGL01987:Abca17 APN 17 24346228 missense probably benign 0.00
IGL01988:Abca17 APN 17 24334255 missense probably damaging 0.99
IGL02223:Abca17 APN 17 24287935 nonsense probably null
IGL02368:Abca17 APN 17 24287793 missense probably benign 0.01
IGL02405:Abca17 APN 17 24279062 missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24298984 missense probably benign 0.05
IGL02607:Abca17 APN 17 24327705 nonsense probably null
IGL02706:Abca17 APN 17 24298992 missense probably benign 0.00
IGL02729:Abca17 APN 17 24280481 missense probably benign 0.06
IGL02818:Abca17 APN 17 24300352 missense probably benign 0.02
IGL02891:Abca17 APN 17 24281366 missense probably damaging 0.99
IGL03236:Abca17 APN 17 24326476 splice site probably benign
IGL03299:Abca17 APN 17 24265591 missense probably damaging 1.00
basin UTSW 17 24318185 missense probably benign 0.01
Bowl UTSW 17 24317238 missense probably benign 0.09
R0018:Abca17 UTSW 17 24313188 splice site probably null
R0467:Abca17 UTSW 17 24313177 splice site probably benign
R0671:Abca17 UTSW 17 24281249 missense probably benign 0.00
R1175:Abca17 UTSW 17 24289351 missense possibly damaging 0.91
R1397:Abca17 UTSW 17 24285759 missense probably benign 0.18
R1398:Abca17 UTSW 17 24328537 missense probably damaging 0.96
R1678:Abca17 UTSW 17 24335620 missense probably benign 0.05
R1696:Abca17 UTSW 17 24267658 missense possibly damaging 0.90
R1781:Abca17 UTSW 17 24267557 missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24267716 missense probably damaging 1.00
R1970:Abca17 UTSW 17 24307575 missense probably benign 0.00
R1997:Abca17 UTSW 17 24285726 missense probably benign 0.02
R2141:Abca17 UTSW 17 24334266 missense probably benign 0.00
R2199:Abca17 UTSW 17 24335624 missense probably benign 0.19
R2394:Abca17 UTSW 17 24281216 splice site probably null
R2442:Abca17 UTSW 17 24328632 missense probably benign 0.02
R2509:Abca17 UTSW 17 24289613 splice site probably benign
R2848:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2849:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2859:Abca17 UTSW 17 24281314 missense possibly damaging 0.46
R2879:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2935:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3153:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3154:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3434:Abca17 UTSW 17 24289537 missense probably damaging 1.00
R3695:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3905:Abca17 UTSW 17 24296283 missense probably benign 0.13
R4282:Abca17 UTSW 17 24299060 missense possibly damaging 0.49
R4334:Abca17 UTSW 17 24318268 missense probably damaging 1.00
R4350:Abca17 UTSW 17 24279046 critical splice donor site probably null
R4548:Abca17 UTSW 17 24334271 missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24321084 missense probably damaging 1.00
R4722:Abca17 UTSW 17 24265429 missense probably damaging 1.00
R4745:Abca17 UTSW 17 24307453 missense probably damaging 1.00
R4818:Abca17 UTSW 17 24317161 missense probably damaging 0.98
R5279:Abca17 UTSW 17 24289414 missense probably damaging 1.00
R5310:Abca17 UTSW 17 24281230 missense probably benign 0.00
R5320:Abca17 UTSW 17 24307567 missense probably damaging 1.00
R5435:Abca17 UTSW 17 24267614 missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24327668 missense probably benign 0.14
R5776:Abca17 UTSW 17 24295158 missense probably benign 0.09
R5928:Abca17 UTSW 17 24318185 missense probably benign 0.01
R6013:Abca17 UTSW 17 24287846 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24318191 missense probably benign 0.00
R6063:Abca17 UTSW 17 24264344 missense unknown
R6404:Abca17 UTSW 17 24265918 missense probably benign 0.13
R6746:Abca17 UTSW 17 24346221 nonsense probably null
R6819:Abca17 UTSW 17 24287793 missense probably benign 0.01
R6828:Abca17 UTSW 17 24326415 missense possibly damaging 0.91
R7043:Abca17 UTSW 17 24265500 missense probably damaging 1.00
R7065:Abca17 UTSW 17 24327751 missense probably damaging 1.00
R7123:Abca17 UTSW 17 24265975 missense probably damaging 1.00
R7157:Abca17 UTSW 17 24335590 missense possibly damaging 0.46
R7188:Abca17 UTSW 17 24335626 missense possibly damaging 0.89
R7294:Abca17 UTSW 17 24321009 missense not run
R7352:Abca17 UTSW 17 24289054 nonsense probably null
R7355:Abca17 UTSW 17 24267647 missense probably benign 0.00
R7358:Abca17 UTSW 17 24291555 missense probably benign 0.00
R7411:Abca17 UTSW 17 24328569 missense possibly damaging 0.52
R7915:Abca17 UTSW 17 24265533 missense probably damaging 1.00
R8039:Abca17 UTSW 17 24328725 missense probably damaging 1.00
R8095:Abca17 UTSW 17 24317222 missense possibly damaging 0.77
R8308:Abca17 UTSW 17 24267683 missense probably damaging 1.00
R8517:Abca17 UTSW 17 24317233 missense probably benign 0.00
R8811:Abca17 UTSW 17 24317238 missense probably benign 0.09
R8819:Abca17 UTSW 17 24328602 missense probably damaging 1.00
R8953:Abca17 UTSW 17 24299041 missense probably benign
R9095:Abca17 UTSW 17 24281396 missense probably damaging 0.97
R9313:Abca17 UTSW 17 24346233 missense probably benign 0.00
R9314:Abca17 UTSW 17 24328619 missense possibly damaging 0.91
R9347:Abca17 UTSW 17 24264505 missense probably benign
R9351:Abca17 UTSW 17 24291777 missense probably benign 0.00
R9387:Abca17 UTSW 17 24334281 missense probably benign 0.02
R9388:Abca17 UTSW 17 24264299 missense unknown
RF024:Abca17 UTSW 17 24287732 frame shift probably null
RF029:Abca17 UTSW 17 24287727 critical splice donor site probably benign
RF032:Abca17 UTSW 17 24287727 frame shift probably null
RF036:Abca17 UTSW 17 24287727 critical splice donor site probably benign
X0017:Abca17 UTSW 17 24317163 missense probably benign 0.26
X0065:Abca17 UTSW 17 24334284 missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24279079 missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24279107 missense probably benign 0.03
Z1088:Abca17 UTSW 17 24346219 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCAGTATCAAGAGACGGTACTC -3'
(R):5'- TTCCTGGCCATACAGCATGC -3'

Sequencing Primer
(F):5'- TCCCTCCTACAGATAAGAAAGTGTTC -3'
(R):5'- TGCCGTAGACAAAGCGATTATGC -3'
Posted On 2021-04-30