Incidental Mutation 'R8820:Pdzph1'
ID673008
Institutional Source Beutler Lab
Gene Symbol Pdzph1
Ensembl Gene ENSMUSG00000024227
Gene NamePDZ and pleckstrin homology domains 1
Synonyms2610034M16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R8820 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location58878808-58991375 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to C at 58880720 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1168 (Y1168*)
Ref Sequence ENSEMBL: ENSMUSP00000025064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025064] [ENSMUST00000177360]
Predicted Effect probably null
Transcript: ENSMUST00000025064
AA Change: Y1168*
SMART Domains Protein: ENSMUSP00000025064
Gene: ENSMUSG00000024227
AA Change: Y1168*

DomainStartEndE-ValueType
Blast:PDZ 780 844 6e-20 BLAST
PDZ 915 984 3.31e-15 SMART
PH 993 1096 9.4e-19 SMART
PH 1120 1218 2.83e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000177360
AA Change: Y128*
SMART Domains Protein: ENSMUSP00000135180
Gene: ENSMUSG00000024227
AA Change: Y128*

DomainStartEndE-ValueType
SCOP:d1faoa_ 1 54 1e-4 SMART
Blast:PH 1 56 4e-33 BLAST
PH 80 178 2.83e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,726,454 F873L possibly damaging Het
4930504O13Rik T G 11: 58,446,303 S115R probably damaging Het
Abca17 A G 17: 24,328,602 L266P probably damaging Het
Abcb1a A T 5: 8,723,204 T811S possibly damaging Het
Als2cl T C 9: 110,885,787 F125L probably benign Het
Arhgap33 T C 7: 30,528,740 I406V probably benign Het
Cdyl T C 13: 35,858,191 I404T probably damaging Het
Clasrp C T 7: 19,586,437 R432H unknown Het
Clk2 T A 3: 89,175,423 M392K probably damaging Het
Cps1 T A 1: 67,228,280 N1402K possibly damaging Het
Cyp2u1 T C 3: 131,298,367 H168R probably damaging Het
Dapl1 T C 2: 59,504,712 L70P probably damaging Het
Ddr2 T A 1: 169,977,914 K836* probably null Het
Dsel A G 1: 111,860,264 L847P probably benign Het
Fbxw17 A T 13: 50,433,315 K437M possibly damaging Het
Fktn T C 4: 53,735,001 V174A possibly damaging Het
Frem1 C A 4: 82,903,517 S2118I probably damaging Het
Fzd8 G A 18: 9,213,247 V110M unknown Het
Gabrb3 T C 7: 57,792,581 S212P probably damaging Het
Gimap9 A G 6: 48,677,887 D136G probably benign Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ift46 C T 9: 44,790,522 T283I probably damaging Het
Il1f8 C T 2: 24,159,880 Q168* probably null Het
Ldb2 G A 5: 44,799,415 Q27* probably null Het
Lmcd1 T A 6: 112,329,809 I314N probably damaging Het
Mctp2 C A 7: 72,229,333 V259L probably benign Het
Midn T G 10: 80,154,400 S302A probably damaging Het
Ncor2 A G 5: 125,029,227 V797A Het
Npm2 A G 14: 70,648,328 S146P probably damaging Het
Npr1 G A 3: 90,464,894 R204C probably damaging Het
Olfr338 T C 2: 36,376,994 S73P probably damaging Het
Olfr353 C A 2: 36,890,610 M79I probably benign Het
Olfr49 C T 14: 54,282,613 G94D probably benign Het
Olfr665 T A 7: 104,881,655 V316D possibly damaging Het
Orc2 T C 1: 58,476,480 N290D probably benign Het
Paip2b A C 6: 83,814,756 M48R probably damaging Het
Pcdhb15 T A 18: 37,473,918 S68T probably benign Het
Pcnx T A 12: 81,973,248 H715Q Het
Pcsk2 T A 2: 143,801,070 H422Q probably damaging Het
Peli2 G A 14: 48,252,673 E201K possibly damaging Het
Prelp T C 1: 133,915,140 N89S probably damaging Het
Proz T A 8: 13,063,253 F25I probably damaging Het
Rapgef3 T C 15: 97,748,657 N799S probably benign Het
Ryr3 G A 2: 112,635,792 R4795W probably damaging Het
Ryr3 A G 2: 112,859,724 V1180A probably benign Het
Scn11a T C 9: 119,816,520 I123V probably benign Het
Sema4b G C 7: 80,220,500 E475D probably damaging Het
Serinc2 C A 4: 130,255,379 M343I probably damaging Het
Serinc5 G T 13: 92,708,036 V429F probably benign Het
Smyd2 T A 1: 189,899,821 K115N probably benign Het
Tenm3 T G 8: 48,310,724 D765A probably damaging Het
Tmem2 G A 19: 21,807,454 V434M probably damaging Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Unc13d ATGCCTCCC ATGCCTCCCCTGCCTCCC 11: 116,068,173 probably benign Het
Ythdc2 C T 18: 44,834,464 R176* probably null Het
Zfp27 T C 7: 29,894,588 K651E probably benign Het
Other mutations in Pdzph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Pdzph1 APN 17 58974796 missense possibly damaging 0.46
IGL00644:Pdzph1 APN 17 58888110 missense probably benign
IGL01413:Pdzph1 APN 17 58879152 missense possibly damaging 0.82
IGL01530:Pdzph1 APN 17 58922715 missense probably damaging 1.00
IGL02089:Pdzph1 APN 17 58967339 missense possibly damaging 0.92
IGL02201:Pdzph1 APN 17 58967511 splice site probably benign
IGL02548:Pdzph1 APN 17 58973391 missense probably benign 0.10
IGL02618:Pdzph1 APN 17 58879073 utr 3 prime probably benign
IGL02660:Pdzph1 APN 17 58880647 missense probably damaging 0.97
IGL02749:Pdzph1 APN 17 58932483 missense possibly damaging 0.95
IGL02876:Pdzph1 APN 17 58974069 missense probably benign
IGL03304:Pdzph1 APN 17 58880646 missense probably damaging 1.00
IGL03336:Pdzph1 APN 17 58974234 missense probably benign 0.00
R0008:Pdzph1 UTSW 17 58922761 splice site probably benign
R0008:Pdzph1 UTSW 17 58922761 splice site probably benign
R0498:Pdzph1 UTSW 17 58973830 missense probably benign 0.00
R0553:Pdzph1 UTSW 17 58922727 missense probably damaging 1.00
R0594:Pdzph1 UTSW 17 58954479 missense possibly damaging 0.76
R1306:Pdzph1 UTSW 17 58932432 missense possibly damaging 0.90
R1370:Pdzph1 UTSW 17 58974087 missense possibly damaging 0.73
R1382:Pdzph1 UTSW 17 58974747 missense probably benign 0.10
R1463:Pdzph1 UTSW 17 58932445 missense probably damaging 1.00
R1766:Pdzph1 UTSW 17 58973752 missense probably benign 0.16
R1773:Pdzph1 UTSW 17 58974813 missense probably damaging 0.98
R1862:Pdzph1 UTSW 17 58922583 missense probably damaging 1.00
R2070:Pdzph1 UTSW 17 58974097 missense probably benign 0.04
R2071:Pdzph1 UTSW 17 58974097 missense probably benign 0.04
R2229:Pdzph1 UTSW 17 58932412 splice site probably benign
R2264:Pdzph1 UTSW 17 58888167 critical splice acceptor site probably null
R2334:Pdzph1 UTSW 17 58922649 missense probably damaging 1.00
R3750:Pdzph1 UTSW 17 58973336 nonsense probably null
R4700:Pdzph1 UTSW 17 58974546 missense probably damaging 0.98
R4847:Pdzph1 UTSW 17 58973530 missense possibly damaging 0.95
R4868:Pdzph1 UTSW 17 58974756 missense probably benign 0.00
R5130:Pdzph1 UTSW 17 58922609 missense probably damaging 1.00
R5329:Pdzph1 UTSW 17 58974880 missense probably damaging 1.00
R5574:Pdzph1 UTSW 17 58973947 missense probably benign 0.00
R5770:Pdzph1 UTSW 17 58879151 missense probably damaging 1.00
R5795:Pdzph1 UTSW 17 58885867 missense possibly damaging 0.47
R5842:Pdzph1 UTSW 17 58974412 missense possibly damaging 0.64
R5851:Pdzph1 UTSW 17 58973746 missense probably benign 0.02
R6158:Pdzph1 UTSW 17 58973627 missense probably damaging 0.96
R6813:Pdzph1 UTSW 17 58974436 missense probably benign 0.08
R7022:Pdzph1 UTSW 17 58974126 missense probably benign 0.02
R7395:Pdzph1 UTSW 17 58879159 missense possibly damaging 0.85
R7525:Pdzph1 UTSW 17 58967341 missense possibly damaging 0.73
R7944:Pdzph1 UTSW 17 58932460 missense probably damaging 1.00
R7945:Pdzph1 UTSW 17 58932460 missense probably damaging 1.00
R7992:Pdzph1 UTSW 17 58879110 missense possibly damaging 0.71
R8016:Pdzph1 UTSW 17 58932481 missense probably damaging 0.98
R8116:Pdzph1 UTSW 17 58975143 missense probably benign 0.01
R8273:Pdzph1 UTSW 17 58973014 missense probably benign 0.00
R8523:Pdzph1 UTSW 17 58884013 missense probably damaging 1.00
R8819:Pdzph1 UTSW 17 58880720 nonsense probably null
R8839:Pdzph1 UTSW 17 58950242 missense probably benign 0.02
R8871:Pdzph1 UTSW 17 58888038 missense probably damaging 1.00
R8898:Pdzph1 UTSW 17 58974339 missense probably benign 0.00
R8959:Pdzph1 UTSW 17 58974604 missense probably damaging 0.97
X0028:Pdzph1 UTSW 17 58879121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATAGCGGGGATGCATTTG -3'
(R):5'- GCATTTTAGTGTCAACCTATGGG -3'

Sequencing Primer
(F):5'- GTTTGTCAAGGCTCACACAG -3'
(R):5'- TGGGATTTCAACTCAGGACC -3'
Posted On2021-04-30