Mutagenetix > Incidental Mutation

Incidental Mutation 'R8820:Pcdhb15'

673010

Institutional Source

Beutler Lab

Gene Symbol

Pcdhb15

Ensembl Gene

ENSMUSG00000047033

Gene Name

protocadherin beta 15

Synonyms

PcdhbO, Pcdhb7

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R8820 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

37473540-37476340 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 37473918 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 68 (S68T)

Ref Sequence

ENSEMBL: ENSMUSP00000059598 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050034] [ENSMUST00000051442] [ENSMUST00000115661] [ENSMUST00000194544]

AlphaFold

Q91Y04

Predicted Effect

probably benign
Transcript: ENSMUST00000050034
AA Change: S68T

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000059598
Gene: ENSMUSG00000047033
AA Change: S68T

Domain	Start	End	E-Value	Type
Pfam:Cadherin_2	30	112	2.6e-33	PFAM
CA	155	240	7.79e-22	SMART
CA	264	345	4.37e-25	SMART
CA	368	449	4.4e-21	SMART
CA	473	559	7.38e-23	SMART
CA	589	670	4.48e-13	SMART
Pfam:Cadherin_C_2	686	770	5.3e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000051442

SMART Domains

Protein: ENSMUSP00000056347
Gene: ENSMUSG00000047910

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	46	132	7.7e-1	SMART
CA	156	241	1.93e-17	SMART
CA	265	346	4.2e-27	SMART
CA	369	450	1.08e-24	SMART
CA	474	560	3.31e-25	SMART
CA	590	671	2.87e-11	SMART
Pfam:Cadherin_C_2	687	770	4.1e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115661

SMART Domains

Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

Domain	Start	End	E-Value	Type
CA	20	131	5.3e-2	SMART
CA	155	240	1.51e-19	SMART
CA	264	348	7.6e-25	SMART
CA	372	453	1.42e-24	SMART
CA	477	563	1.42e-24	SMART
CA	594	674	4.12e-12	SMART
low complexity region	706	721	N/A	INTRINSIC
Pfam:Cadherin_tail	796	930	3.9e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000193984

Predicted Effect

probably benign
Transcript: ENSMUST00000194544

SMART Domains

Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

Domain	Start	End	E-Value	Type
Blast:CA	18	66	5e-20	BLAST

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. The transcript for this particular family member uses more than one polyadenylation site. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,726,454	F873L	possibly damaging	Het
4930504O13Rik	T	G	11: 58,446,303	S115R	probably damaging	Het
Abca17	A	G	17: 24,328,602	L266P	probably damaging	Het
Abcb1a	A	T	5: 8,723,204	T811S	possibly damaging	Het
Als2cl	T	C	9: 110,885,787	F125L	probably benign	Het
Arhgap33	T	C	7: 30,528,740	I406V	probably benign	Het
Cdyl	T	C	13: 35,858,191	I404T	probably damaging	Het
Clasrp	C	T	7: 19,586,437	R432H	unknown	Het
Clk2	T	A	3: 89,175,423	M392K	probably damaging	Het
Cps1	T	A	1: 67,228,280	N1402K	possibly damaging	Het
Cyp2u1	T	C	3: 131,298,367	H168R	probably damaging	Het
Dapl1	T	C	2: 59,504,712	L70P	probably damaging	Het
Ddr2	T	A	1: 169,977,914	K836*	probably null	Het
Dsel	A	G	1: 111,860,264	L847P	probably benign	Het
Fbxw17	A	T	13: 50,433,315	K437M	possibly damaging	Het
Fktn	T	C	4: 53,735,001	V174A	possibly damaging	Het
Frem1	C	A	4: 82,903,517	S2118I	probably damaging	Het
Fzd8	G	A	18: 9,213,247	V110M	unknown	Het
Gabrb3	T	C	7: 57,792,581	S212P	probably damaging	Het
Gimap9	A	G	6: 48,677,887	D136G	probably benign	Het
Gldc	C	G	19: 30,100,812	M928I	probably benign	Het
Hmmr	G	A	11: 40,721,672	S206F	probably damaging	Het
Ift46	C	T	9: 44,790,522	T283I	probably damaging	Het
Il1f8	C	T	2: 24,159,880	Q168*	probably null	Het
Ldb2	G	A	5: 44,799,415	Q27*	probably null	Het
Lmcd1	T	A	6: 112,329,809	I314N	probably damaging	Het
Mctp2	C	A	7: 72,229,333	V259L	probably benign	Het
Midn	T	G	10: 80,154,400	S302A	probably damaging	Het
Ncor2	A	G	5: 125,029,227	V797A		Het
Npm2	A	G	14: 70,648,328	S146P	probably damaging	Het
Npr1	G	A	3: 90,464,894	R204C	probably damaging	Het
Olfr338	T	C	2: 36,376,994	S73P	probably damaging	Het
Olfr353	C	A	2: 36,890,610	M79I	probably benign	Het
Olfr49	C	T	14: 54,282,613	G94D	probably benign	Het
Olfr665	T	A	7: 104,881,655	V316D	possibly damaging	Het
Orc2	T	C	1: 58,476,480	N290D	probably benign	Het
Paip2b	A	C	6: 83,814,756	M48R	probably damaging	Het
Pcnx	T	A	12: 81,973,248	H715Q		Het
Pcsk2	T	A	2: 143,801,070	H422Q	probably damaging	Het
Pdzph1	G	C	17: 58,880,720	Y1168*	probably null	Het
Peli2	G	A	14: 48,252,673	E201K	possibly damaging	Het
Prelp	T	C	1: 133,915,140	N89S	probably damaging	Het
Proz	T	A	8: 13,063,253	F25I	probably damaging	Het
Rapgef3	T	C	15: 97,748,657	N799S	probably benign	Het
Ryr3	G	A	2: 112,635,792	R4795W	probably damaging	Het
Ryr3	A	G	2: 112,859,724	V1180A	probably benign	Het
Scn11a	T	C	9: 119,816,520	I123V	probably benign	Het
Sema4b	G	C	7: 80,220,500	E475D	probably damaging	Het
Serinc2	C	A	4: 130,255,379	M343I	probably damaging	Het
Serinc5	G	T	13: 92,708,036	V429F	probably benign	Het
Smyd2	T	A	1: 189,899,821	K115N	probably benign	Het
Tenm3	T	G	8: 48,310,724	D765A	probably damaging	Het
Tmem2	G	A	19: 21,807,454	V434M	probably damaging	Het
Unc13d	AATGCCTCCCATGCC	AATGCCTCCCATGCCTCCCATGCC	11: 116,068,172		probably benign	Het
Ythdc2	C	T	18: 44,834,464	R176*	probably null	Het
Zfp27	T	C	7: 29,894,588	K651E	probably benign	Het

Other mutations in Pcdhb15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00530:Pcdhb15	APN	18	37475154	missense	probably damaging	1.00
IGL01536:Pcdhb15	APN	18	37474993	missense	probably benign	0.01
IGL01664:Pcdhb15	APN	18	37474261	missense	probably benign	0.35
IGL02001:Pcdhb15	APN	18	37474038	missense	probably benign	0.01
IGL02161:Pcdhb15	APN	18	37475502	missense	possibly damaging	0.78
IGL02205:Pcdhb15	APN	18	37473957	missense	probably damaging	0.99
IGL02748:Pcdhb15	APN	18	37475220	missense	probably damaging	0.98
IGL02828:Pcdhb15	APN	18	37473850	missense	probably damaging	0.97
IGL02974:Pcdhb15	APN	18	37475014	missense	probably damaging	1.00
IGL03119:Pcdhb15	APN	18	37475014	missense	probably damaging	1.00
IGL03136:Pcdhb15	APN	18	37475014	missense	probably damaging	1.00
IGL03150:Pcdhb15	APN	18	37475014	missense	probably damaging	1.00
PIT1430001:Pcdhb15	UTSW	18	37475671	missense	probably benign	0.15
R0266:Pcdhb15	UTSW	18	37475276	missense	probably damaging	1.00
R0288:Pcdhb15	UTSW	18	37475398	missense	probably damaging	1.00
R0399:Pcdhb15	UTSW	18	37474168	missense	possibly damaging	0.56
R0400:Pcdhb15	UTSW	18	37475895	missense	probably benign
R0554:Pcdhb15	UTSW	18	37474519	missense	probably damaging	1.00
R0637:Pcdhb15	UTSW	18	37475566	missense	probably damaging	1.00
R0714:Pcdhb15	UTSW	18	37474621	missense	probably damaging	0.98
R1118:Pcdhb15	UTSW	18	37473762	missense	probably benign	0.01
R1423:Pcdhb15	UTSW	18	37473922	missense	probably damaging	0.97
R1672:Pcdhb15	UTSW	18	37474660	missense	probably damaging	1.00
R1681:Pcdhb15	UTSW	18	37473813	missense	probably damaging	1.00
R1779:Pcdhb15	UTSW	18	37476031	missense	possibly damaging	0.95
R2206:Pcdhb15	UTSW	18	37475022	missense	probably benign	0.05
R2207:Pcdhb15	UTSW	18	37475022	missense	probably benign	0.05
R2274:Pcdhb15	UTSW	18	37475443	missense	probably damaging	1.00
R3406:Pcdhb15	UTSW	18	37475389	missense	probably benign	0.41
R3407:Pcdhb15	UTSW	18	37474389	missense	possibly damaging	0.80
R3417:Pcdhb15	UTSW	18	37475163	missense	probably damaging	1.00
R3752:Pcdhb15	UTSW	18	37473757	missense	probably damaging	1.00
R3773:Pcdhb15	UTSW	18	37475890	missense	probably benign	0.00
R4432:Pcdhb15	UTSW	18	37475512	missense	probably damaging	1.00
R4433:Pcdhb15	UTSW	18	37475512	missense	probably damaging	1.00
R4583:Pcdhb15	UTSW	18	37475575	missense	possibly damaging	0.91
R4612:Pcdhb15	UTSW	18	37475595	missense	probably damaging	0.96
R4988:Pcdhb15	UTSW	18	37475802	missense	probably damaging	0.98
R5635:Pcdhb15	UTSW	18	37473770	nonsense	probably null
R5692:Pcdhb15	UTSW	18	37474449	missense	probably benign	0.01
R5742:Pcdhb15	UTSW	18	37474767	missense	probably damaging	0.99
R5913:Pcdhb15	UTSW	18	37474654	missense	probably benign	0.07
R6350:Pcdhb15	UTSW	18	37475361	missense	probably damaging	1.00
R6522:Pcdhb15	UTSW	18	37474261	missense	probably benign	0.35
R6676:Pcdhb15	UTSW	18	37474807	missense	possibly damaging	0.60
R6693:Pcdhb15	UTSW	18	37474341	missense	probably benign	0.01
R6905:Pcdhb15	UTSW	18	37474695	missense	possibly damaging	0.95
R7029:Pcdhb15	UTSW	18	37475568	missense	possibly damaging	0.85
R7335:Pcdhb15	UTSW	18	37474336	missense	probably damaging	1.00
R7529:Pcdhb15	UTSW	18	37474473	nonsense	probably null
R7718:Pcdhb15	UTSW	18	37475163	missense	probably damaging	1.00
R7782:Pcdhb15	UTSW	18	37474735	missense	possibly damaging	0.88
R7967:Pcdhb15	UTSW	18	37474849	missense	probably damaging	1.00
R8170:Pcdhb15	UTSW	18	37475584	missense	probably damaging	1.00
R8323:Pcdhb15	UTSW	18	37475662	missense	probably benign	0.18
R8725:Pcdhb15	UTSW	18	37475681	missense	probably damaging	0.99
R9117:Pcdhb15	UTSW	18	37475037	missense	probably damaging	1.00
R9280:Pcdhb15	UTSW	18	37474741	missense	probably damaging	1.00
R9367:Pcdhb15	UTSW	18	37474918	missense	possibly damaging	0.95
R9424:Pcdhb15	UTSW	18	37474210	missense
R9432:Pcdhb15	UTSW	18	37475630	missense	probably benign	0.04
R9498:Pcdhb15	UTSW	18	37473837	nonsense	probably null
R9544:Pcdhb15	UTSW	18	37475895	missense	probably benign
X0062:Pcdhb15	UTSW	18	37476015	nonsense	probably null
X0063:Pcdhb15	UTSW	18	37475084	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTGCTTGAGGCTAAATGGAAGG -3'
(R):5'- CTTTGATATGTAGTGCAGCGC -3'

Sequencing Primer
(F):5'- CTTGAGGCTAAATGGAAGGAATTTG -3'
(R):5'- TATGTAGTGCAGCGCGATAAATCTG -3'

Posted On

2021-04-30