Incidental Mutation 'R8820:Gldc'
ID 673013
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Name glycine decarboxylase
Synonyms b2b2679Clo, D030049L12Rik, D19Wsu57e
MMRRC Submission 068653-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8820 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 30075847-30152829 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 30078212 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 928 (M928I)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
AlphaFold Q91W43
Predicted Effect probably benign
Transcript: ENSMUST00000025778
AA Change: M928I

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: M928I

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Meta Mutation Damage Score 0.1865 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,547,576 (GRCm39) L266P probably damaging Het
Abcb1a A T 5: 8,773,204 (GRCm39) T811S possibly damaging Het
Als2cl T C 9: 110,714,855 (GRCm39) F125L probably benign Het
Arhgap33 T C 7: 30,228,165 (GRCm39) I406V probably benign Het
Cdyl T C 13: 36,042,174 (GRCm39) I404T probably damaging Het
Cemip2 G A 19: 21,784,818 (GRCm39) V434M probably damaging Het
Clasrp C T 7: 19,320,362 (GRCm39) R432H unknown Het
Clk2 T A 3: 89,082,730 (GRCm39) M392K probably damaging Het
Cps1 T A 1: 67,267,439 (GRCm39) N1402K possibly damaging Het
Cyp2u1 T C 3: 131,092,016 (GRCm39) H168R probably damaging Het
Dapl1 T C 2: 59,335,056 (GRCm39) L70P probably damaging Het
Ddr2 T A 1: 169,805,483 (GRCm39) K836* probably null Het
Dsel A G 1: 111,787,994 (GRCm39) L847P probably benign Het
Fbxw17 A T 13: 50,587,351 (GRCm39) K437M possibly damaging Het
Fktn T C 4: 53,735,001 (GRCm39) V174A possibly damaging Het
Frem1 C A 4: 82,821,754 (GRCm39) S2118I probably damaging Het
Fzd8 G A 18: 9,213,247 (GRCm39) V110M unknown Het
Gabrb3 T C 7: 57,442,329 (GRCm39) S212P probably damaging Het
Gimap9 A G 6: 48,654,821 (GRCm39) D136G probably benign Het
Hmmr G A 11: 40,612,499 (GRCm39) S206F probably damaging Het
Ift46 C T 9: 44,701,819 (GRCm39) T283I probably damaging Het
Il36b C T 2: 24,049,892 (GRCm39) Q168* probably null Het
Ldb2 G A 5: 44,956,757 (GRCm39) Q27* probably null Het
Lmcd1 T A 6: 112,306,770 (GRCm39) I314N probably damaging Het
Lypd9 T G 11: 58,337,129 (GRCm39) S115R probably damaging Het
Mctp2 C A 7: 71,879,081 (GRCm39) V259L probably benign Het
Midn T G 10: 79,990,234 (GRCm39) S302A probably damaging Het
Ncor2 A G 5: 125,106,291 (GRCm39) V797A Het
Npm2 A G 14: 70,885,768 (GRCm39) S146P probably damaging Het
Npr1 G A 3: 90,372,201 (GRCm39) R204C probably damaging Het
Or1j10 T C 2: 36,267,006 (GRCm39) S73P probably damaging Het
Or1n1b C A 2: 36,780,622 (GRCm39) M79I probably benign Het
Or52n3 T A 7: 104,530,862 (GRCm39) V316D possibly damaging Het
Or6e1 C T 14: 54,520,070 (GRCm39) G94D probably benign Het
Orc2 T C 1: 58,515,639 (GRCm39) N290D probably benign Het
Paip2b A C 6: 83,791,738 (GRCm39) M48R probably damaging Het
Pcdhb15 T A 18: 37,606,971 (GRCm39) S68T probably benign Het
Pcnx1 T A 12: 82,020,022 (GRCm39) H715Q Het
Pcsk2 T A 2: 143,642,990 (GRCm39) H422Q probably damaging Het
Pdzph1 G C 17: 59,187,715 (GRCm39) Y1168* probably null Het
Peli2 G A 14: 48,490,130 (GRCm39) E201K possibly damaging Het
Prelp T C 1: 133,842,878 (GRCm39) N89S probably damaging Het
Proz T A 8: 13,113,253 (GRCm39) F25I probably damaging Het
Rapgef3 T C 15: 97,646,538 (GRCm39) N799S probably benign Het
Relch T A 1: 105,654,179 (GRCm39) F873L possibly damaging Het
Ryr3 G A 2: 112,466,137 (GRCm39) R4795W probably damaging Het
Ryr3 A G 2: 112,690,069 (GRCm39) V1180A probably benign Het
Scn11a T C 9: 119,645,586 (GRCm39) I123V probably benign Het
Sema4b G C 7: 79,870,248 (GRCm39) E475D probably damaging Het
Serinc2 C A 4: 130,149,172 (GRCm39) M343I probably damaging Het
Serinc5 G T 13: 92,844,544 (GRCm39) V429F probably benign Het
Smyd2 T A 1: 189,632,018 (GRCm39) K115N probably benign Het
Tenm3 T G 8: 48,763,759 (GRCm39) D765A probably damaging Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 115,958,998 (GRCm39) probably benign Het
Ythdc2 C T 18: 44,967,531 (GRCm39) R176* probably null Het
Zfp27 T C 7: 29,594,013 (GRCm39) K651E probably benign Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30,092,640 (GRCm39) missense probably damaging 1.00
IGL01016:Gldc APN 19 30,110,893 (GRCm39) missense possibly damaging 0.93
IGL01112:Gldc APN 19 30,135,913 (GRCm39) critical splice donor site probably null
IGL01510:Gldc APN 19 30,091,121 (GRCm39) critical splice donor site probably null
IGL01516:Gldc APN 19 30,076,432 (GRCm39) missense probably damaging 1.00
IGL01598:Gldc APN 19 30,111,156 (GRCm39) missense probably damaging 1.00
IGL01646:Gldc APN 19 30,078,165 (GRCm39) missense possibly damaging 0.61
IGL02024:Gldc APN 19 30,078,227 (GRCm39) missense probably damaging 1.00
IGL02125:Gldc APN 19 30,124,641 (GRCm39) missense probably benign 0.03
IGL02548:Gldc APN 19 30,077,299 (GRCm39) missense probably benign
IGL02711:Gldc APN 19 30,122,546 (GRCm39) critical splice donor site probably null
IGL02818:Gldc APN 19 30,113,909 (GRCm39) missense probably damaging 0.99
IGL02982:Gldc APN 19 30,122,545 (GRCm39) critical splice donor site probably null
IGL03165:Gldc APN 19 30,076,393 (GRCm39) missense possibly damaging 0.61
jojoba UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
miserable UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
Urchin UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
I2289:Gldc UTSW 19 30,124,576 (GRCm39) nonsense probably null
R0180:Gldc UTSW 19 30,078,217 (GRCm39) missense possibly damaging 0.95
R0269:Gldc UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
R0277:Gldc UTSW 19 30,093,851 (GRCm39) missense possibly damaging 0.84
R1085:Gldc UTSW 19 30,128,828 (GRCm39) missense probably damaging 1.00
R1159:Gldc UTSW 19 30,138,162 (GRCm39) intron probably benign
R1500:Gldc UTSW 19 30,091,225 (GRCm39) missense possibly damaging 0.88
R1507:Gldc UTSW 19 30,096,038 (GRCm39) missense probably damaging 1.00
R1592:Gldc UTSW 19 30,138,077 (GRCm39) intron probably benign
R1593:Gldc UTSW 19 30,091,150 (GRCm39) missense probably damaging 1.00
R1675:Gldc UTSW 19 30,120,853 (GRCm39) missense probably damaging 1.00
R1869:Gldc UTSW 19 30,116,732 (GRCm39) missense probably benign
R1965:Gldc UTSW 19 30,114,513 (GRCm39) nonsense probably null
R2312:Gldc UTSW 19 30,078,226 (GRCm39) missense probably damaging 0.98
R2425:Gldc UTSW 19 30,109,190 (GRCm39) missense probably damaging 1.00
R3836:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3837:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3839:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R4191:Gldc UTSW 19 30,123,058 (GRCm39) missense probably damaging 0.96
R4380:Gldc UTSW 19 30,138,168 (GRCm39) intron probably benign
R4508:Gldc UTSW 19 30,120,807 (GRCm39) missense probably damaging 1.00
R4570:Gldc UTSW 19 30,151,839 (GRCm39) missense probably benign
R4655:Gldc UTSW 19 30,138,102 (GRCm39) intron probably benign
R4842:Gldc UTSW 19 30,111,132 (GRCm39) missense possibly damaging 0.94
R5070:Gldc UTSW 19 30,095,998 (GRCm39) missense possibly damaging 0.84
R5085:Gldc UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
R5268:Gldc UTSW 19 30,123,125 (GRCm39) missense probably damaging 0.96
R5368:Gldc UTSW 19 30,135,921 (GRCm39) missense probably benign
R5718:Gldc UTSW 19 30,088,172 (GRCm39) nonsense probably null
R5878:Gldc UTSW 19 30,120,867 (GRCm39) splice site probably null
R6192:Gldc UTSW 19 30,111,172 (GRCm39) missense probably damaging 0.98
R6453:Gldc UTSW 19 30,093,917 (GRCm39) missense probably damaging 0.99
R6777:Gldc UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
R6865:Gldc UTSW 19 30,111,162 (GRCm39) missense possibly damaging 0.92
R7332:Gldc UTSW 19 30,093,926 (GRCm39) missense probably damaging 0.99
R7390:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.46
R7647:Gldc UTSW 19 30,096,067 (GRCm39) missense probably damaging 0.96
R8081:Gldc UTSW 19 30,135,987 (GRCm39) frame shift probably null
R8171:Gldc UTSW 19 30,111,161 (GRCm39) missense probably benign 0.24
R8321:Gldc UTSW 19 30,120,807 (GRCm39) nonsense probably null
R8374:Gldc UTSW 19 30,114,594 (GRCm39) missense probably damaging 1.00
R8503:Gldc UTSW 19 30,077,254 (GRCm39) missense probably benign 0.26
R8510:Gldc UTSW 19 30,093,905 (GRCm39) missense probably damaging 1.00
R8785:Gldc UTSW 19 30,092,634 (GRCm39) missense probably damaging 1.00
R8818:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8829:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8830:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8859:Gldc UTSW 19 30,116,779 (GRCm39) missense probably damaging 1.00
R8887:Gldc UTSW 19 30,111,156 (GRCm39) missense possibly damaging 0.94
R8935:Gldc UTSW 19 30,109,093 (GRCm39) missense probably benign 0.00
R8940:Gldc UTSW 19 30,128,884 (GRCm39) missense probably benign
R9070:Gldc UTSW 19 30,080,404 (GRCm39) missense probably damaging 1.00
R9100:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.81
R9144:Gldc UTSW 19 30,114,593 (GRCm39) missense
R9163:Gldc UTSW 19 30,111,686 (GRCm39) missense probably benign 0.13
R9429:Gldc UTSW 19 30,091,172 (GRCm39) missense possibly damaging 0.88
Z1177:Gldc UTSW 19 30,123,148 (GRCm39) missense possibly damaging 0.61
Z1177:Gldc UTSW 19 30,088,179 (GRCm39) missense probably damaging 0.99
Z1177:Gldc UTSW 19 30,088,178 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATTCGAGATTGAAACCTCTG -3'
(R):5'- CCTGCTACTACATAGACGTACC -3'

Sequencing Primer
(F):5'- CGAGATTGAAACCTCTGTGTTTC -3'
(R):5'- TGCTTGTAAAAGCCATGCTAC -3'
Posted On 2021-04-30