Incidental Mutation 'R8821:Tenm3'
ID673047
Institutional Source Beutler Lab
Gene Symbol Tenm3
Ensembl Gene ENSMUSG00000031561
Gene Nameteneurin transmembrane protein 3
SynonymsTen-m3, Odz3, 2610100B16Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.612) question?
Stock #R8821 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location48227682-48843951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 48276382 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 1530 (A1530T)
Ref Sequence ENSEMBL: ENSMUSP00000033965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000190840]
Predicted Effect
SMART Domains Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561
AA Change: A1530T

DomainStartEndE-ValueType
Pfam:Ten_N 11 177 6.9e-91 PFAM
Pfam:Ten_N 171 308 1e-72 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2631 2708 1.5e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190840
AA Change: A1514T

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561
AA Change: A1514T

DomainStartEndE-ValueType
Pfam:Ten_N 10 182 7.6e-77 PFAM
Pfam:Ten_N 168 308 6.6e-50 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2630 2708 3.2e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A T 5: 109,676,308 S425R probably benign Het
A230072I06Rik A T 8: 12,279,688 I48L unknown Het
Abca8a A T 11: 110,058,536 I927K probably damaging Het
Abcc3 A C 11: 94,350,961 C1415G probably damaging Het
Abcf3 C T 16: 20,550,464 R205C probably damaging Het
Aldh3a1 A G 11: 61,216,316 Y282C probably damaging Het
Alyref CCCGCGCGGCGGCCTGCACTGCGCCGCCGCGGCCGCCCTGGGAGCCGGCCCTGCCGCG CCCGCG 11: 120,598,197 probably null Het
Arfgef3 A G 10: 18,652,743 S299P possibly damaging Het
Asic2 A T 11: 81,967,900 N95K probably damaging Het
Btbd18 A G 2: 84,667,257 D413G probably damaging Het
C8b A G 4: 104,790,677 Y355C probably damaging Het
Carm1 A G 9: 21,580,367 E244G probably damaging Het
Cish T A 9: 107,300,472 F116I probably damaging Het
Clasrp C T 7: 19,586,437 R432H unknown Het
Clstn1 G A 4: 149,646,323 R837Q probably benign Het
Col27a1 A G 4: 63,224,911 T279A probably benign Het
Cox10 A G 11: 63,964,480 F325S probably damaging Het
Cpne5 T C 17: 29,211,694 I81V probably benign Het
Ctps A T 4: 120,567,310 S36T possibly damaging Het
Dchs2 T C 3: 83,285,363 L1705P probably benign Het
Dcstamp A G 15: 39,754,789 H198R probably benign Het
Dhx58 T A 11: 100,703,980 K30M probably damaging Het
Dnah1 C T 14: 31,296,498 A1392T probably benign Het
Dnah14 C A 1: 181,792,004 Y3964* probably null Het
Dnah8 T C 17: 30,794,738 S3818P probably damaging Het
Dnmt3b T A 2: 153,676,814 N632K probably benign Het
Drc7 G A 8: 95,062,217 R301Q probably damaging Het
Dsg1a T C 18: 20,320,308 V21A probably damaging Het
Dtd1 T C 2: 144,617,341 L95P probably benign Het
Efhb A T 17: 53,400,744 probably benign Het
Fam186b T A 15: 99,280,852 M198L possibly damaging Het
Fam193a A G 5: 34,459,030 T850A probably benign Het
Fan1 G A 7: 64,354,501 P739L probably damaging Het
Flii A T 11: 60,725,248 N28K probably benign Het
Fmo3 T C 1: 162,968,838 Y55C probably damaging Het
Gatsl2 T A 5: 134,135,253 V96E possibly damaging Het
Gfi1 G A 5: 107,720,272 R377C probably damaging Het
Gm10093 T A 17: 78,492,540 L320Q probably damaging Het
Gm4450 A T 3: 98,446,731 W151R probably benign Het
Gm884 A T 11: 103,619,644 D499E unknown Het
Gm9195 C T 14: 72,480,096 E266K possibly damaging Het
Helz A T 11: 107,635,093 M825L probably damaging Het
Ift80 G A 3: 68,962,250 A236V probably damaging Het
Il1rn A T 2: 24,349,493 T134S possibly damaging Het
Imp4 T C 1: 34,444,364 M257T probably benign Het
Impdh2 T C 9: 108,564,758 L377S probably damaging Het
Kcnrg T C 14: 61,607,532 V7A possibly damaging Het
Kdm1b C A 13: 47,064,141 L359I possibly damaging Het
Lima1 T A 15: 99,806,425 T288S probably benign Het
Lrrc4c A T 2: 97,629,695 D222V possibly damaging Het
Mybpc3 T A 2: 91,118,179 V4E probably null Het
Ncor1 A T 11: 62,369,408 D505E probably benign Het
Nell1 A G 7: 50,826,349 S579G probably damaging Het
Npc1 T A 18: 12,200,820 M735L probably benign Het
Olfr1246 A G 2: 89,590,536 I193T probably damaging Het
Olfr341 G A 2: 36,479,782 T116I possibly damaging Het
Olfr520 A G 7: 99,735,686 H181R possibly damaging Het
Pcdhb12 A G 18: 37,437,333 M511V probably benign Het
Peli2 G A 14: 48,252,673 E201K possibly damaging Het
Phf3 T A 1: 30,821,266 K828* probably null Het
Pih1d1 A G 7: 45,156,772 D44G possibly damaging Het
Prag1 A T 8: 36,146,737 T1148S probably benign Het
Ptpn18 A T 1: 34,472,190 R338W probably null Het
Slc7a6os A T 8: 106,210,557 D90E probably benign Het
Sp7 T A 15: 102,358,792 H211L possibly damaging Het
Ssh3 A G 19: 4,269,025 V19A possibly damaging Het
Tcp11l2 A G 10: 84,613,658 I496V probably damaging Het
Tmem232 A G 17: 65,436,372 L308P probably damaging Het
Tulp4 A G 17: 6,139,134 N77S probably damaging Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Usp48 A T 4: 137,613,769 D360V probably damaging Het
Vmn2r84 G A 10: 130,391,099 A290V probably benign Het
Zfp512b T C 2: 181,586,732 N738S probably benign Het
Other mutations in Tenm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Tenm3 APN 8 48417060 missense probably damaging 1.00
IGL00538:Tenm3 APN 8 48236025 missense probably damaging 1.00
IGL00719:Tenm3 APN 8 48279042 missense probably benign 0.39
IGL00720:Tenm3 APN 8 48276421 missense probably damaging 0.98
IGL00870:Tenm3 APN 8 48417132 missense probably benign 0.00
IGL00976:Tenm3 APN 8 48256841 missense probably benign 0.14
IGL01469:Tenm3 APN 8 48236423 missense probably damaging 1.00
IGL01508:Tenm3 APN 8 48276645 missense probably benign 0.09
IGL01590:Tenm3 APN 8 48228802 missense probably damaging 1.00
IGL01610:Tenm3 APN 8 48254477 missense probably damaging 1.00
IGL01874:Tenm3 APN 8 48236758 nonsense probably null
IGL01892:Tenm3 APN 8 48276396 missense probably benign 0.09
IGL02098:Tenm3 APN 8 48276576 missense possibly damaging 0.94
IGL02382:Tenm3 APN 8 48235476 missense probably damaging 1.00
IGL02397:Tenm3 APN 8 48236694 missense possibly damaging 0.94
IGL02475:Tenm3 APN 8 48279198 splice site probably benign
IGL02502:Tenm3 APN 8 48288016 missense probably damaging 1.00
IGL02508:Tenm3 APN 8 48299639 missense probably benign 0.30
IGL02543:Tenm3 APN 8 48298956 missense probably damaging 1.00
IGL02723:Tenm3 APN 8 48276903 missense probably benign 0.02
IGL03037:Tenm3 APN 8 48298878 missense possibly damaging 0.90
IGL03160:Tenm3 APN 8 48646418 missense probably benign 0.05
IGL03268:Tenm3 APN 8 48235523 missense probably damaging 1.00
IGL02988:Tenm3 UTSW 8 48235346 missense probably damaging 0.99
PIT4431001:Tenm3 UTSW 8 48235607 missense probably damaging 1.00
PIT4504001:Tenm3 UTSW 8 48293657 missense probably damaging 1.00
R0079:Tenm3 UTSW 8 48343345 missense possibly damaging 0.90
R0121:Tenm3 UTSW 8 48342659 missense probably damaging 0.99
R0123:Tenm3 UTSW 8 48674472 missense probably damaging 1.00
R0134:Tenm3 UTSW 8 48674472 missense probably damaging 1.00
R0147:Tenm3 UTSW 8 48236720 missense probably damaging 1.00
R0148:Tenm3 UTSW 8 48236720 missense probably damaging 1.00
R0309:Tenm3 UTSW 8 48341034 missense probably damaging 1.00
R0322:Tenm3 UTSW 8 48236912 splice site probably benign
R0335:Tenm3 UTSW 8 48232105 missense probably damaging 1.00
R0355:Tenm3 UTSW 8 48228975 missense probably damaging 1.00
R0411:Tenm3 UTSW 8 48287791 missense possibly damaging 0.61
R0505:Tenm3 UTSW 8 48341160 splice site probably benign
R0573:Tenm3 UTSW 8 48674399 splice site probably benign
R0599:Tenm3 UTSW 8 48277710 missense probably damaging 1.00
R0616:Tenm3 UTSW 8 48276156 missense possibly damaging 0.76
R0637:Tenm3 UTSW 8 48236525 missense probably damaging 1.00
R0726:Tenm3 UTSW 8 48236594 missense probably damaging 1.00
R0840:Tenm3 UTSW 8 48335742 missense probably damaging 0.99
R0981:Tenm3 UTSW 8 48298965 missense probably damaging 1.00
R1006:Tenm3 UTSW 8 48228542 missense probably damaging 1.00
R1199:Tenm3 UTSW 8 48235582 missense probably damaging 0.99
R1223:Tenm3 UTSW 8 48240396 missense possibly damaging 0.72
R1240:Tenm3 UTSW 8 48287893 missense possibly damaging 0.74
R1394:Tenm3 UTSW 8 48276400 missense probably benign
R1455:Tenm3 UTSW 8 48279048 missense possibly damaging 0.87
R1459:Tenm3 UTSW 8 48235971 missense probably damaging 1.00
R1473:Tenm3 UTSW 8 48310625 missense probably damaging 1.00
R1501:Tenm3 UTSW 8 48343316 missense probably damaging 0.99
R1507:Tenm3 UTSW 8 48287822 missense probably benign 0.01
R1522:Tenm3 UTSW 8 48395576 missense probably damaging 1.00
R1524:Tenm3 UTSW 8 48228981 missense possibly damaging 0.92
R1553:Tenm3 UTSW 8 48236421 missense probably damaging 1.00
R1572:Tenm3 UTSW 8 48228993 missense possibly damaging 0.94
R1583:Tenm3 UTSW 8 48279074 missense probably benign 0.09
R1676:Tenm3 UTSW 8 48417119 missense possibly damaging 0.83
R1732:Tenm3 UTSW 8 48310634 missense probably damaging 1.00
R1768:Tenm3 UTSW 8 48232104 missense probably damaging 1.00
R1777:Tenm3 UTSW 8 48417179 missense probably benign 0.05
R1793:Tenm3 UTSW 8 48674544 missense probably damaging 0.98
R1801:Tenm3 UTSW 8 48276256 missense probably benign 0.39
R1863:Tenm3 UTSW 8 48276346 missense probably benign 0.20
R1898:Tenm3 UTSW 8 48310761 missense probably damaging 1.00
R1971:Tenm3 UTSW 8 48236313 missense probably damaging 1.00
R1972:Tenm3 UTSW 8 48228591 missense probably damaging 1.00
R1996:Tenm3 UTSW 8 48228668 missense probably damaging 1.00
R2061:Tenm3 UTSW 8 48342256 critical splice donor site probably null
R2109:Tenm3 UTSW 8 48343349 missense possibly damaging 0.94
R2124:Tenm3 UTSW 8 48417006 critical splice donor site probably null
R2190:Tenm3 UTSW 8 48395544 missense probably damaging 1.00
R2204:Tenm3 UTSW 8 48674550 missense probably benign 0.17
R2233:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2234:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2235:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2237:Tenm3 UTSW 8 48342337 missense probably damaging 1.00
R2418:Tenm3 UTSW 8 48276658 missense possibly damaging 0.87
R2419:Tenm3 UTSW 8 48276658 missense possibly damaging 0.87
R2435:Tenm3 UTSW 8 48287953 missense probably damaging 1.00
R2483:Tenm3 UTSW 8 48240270 missense probably damaging 0.99
R3406:Tenm3 UTSW 8 48228555 missense probably damaging 1.00
R3724:Tenm3 UTSW 8 48277746 missense probably damaging 0.97
R4009:Tenm3 UTSW 8 48349223 missense probably damaging 1.00
R4210:Tenm3 UTSW 8 48349404 missense probably damaging 1.00
R4293:Tenm3 UTSW 8 48395658 missense probably damaging 1.00
R4656:Tenm3 UTSW 8 48293726 missense probably damaging 1.00
R4663:Tenm3 UTSW 8 48235970 missense probably damaging 1.00
R4835:Tenm3 UTSW 8 48313236 critical splice donor site probably null
R4851:Tenm3 UTSW 8 48310621 critical splice donor site probably null
R4867:Tenm3 UTSW 8 48235821 missense probably damaging 1.00
R4892:Tenm3 UTSW 8 48276861 missense probably damaging 0.99
R4895:Tenm3 UTSW 8 48300971 missense probably damaging 1.00
R4962:Tenm3 UTSW 8 48278961 nonsense probably null
R4995:Tenm3 UTSW 8 48229137 missense possibly damaging 0.87
R4996:Tenm3 UTSW 8 48235826 missense probably damaging 0.97
R5091:Tenm3 UTSW 8 48342308 missense probably benign 0.14
R5228:Tenm3 UTSW 8 48236355 missense probably damaging 1.00
R5253:Tenm3 UTSW 8 48229198 missense possibly damaging 0.92
R5260:Tenm3 UTSW 8 48236855 missense probably damaging 1.00
R5363:Tenm3 UTSW 8 48287831 missense possibly damaging 0.55
R5414:Tenm3 UTSW 8 48236355 missense probably damaging 1.00
R5427:Tenm3 UTSW 8 48236564 missense probably damaging 1.00
R5431:Tenm3 UTSW 8 48367377 nonsense probably null
R5566:Tenm3 UTSW 8 48279006 missense probably damaging 1.00
R5579:Tenm3 UTSW 8 48236764 missense probably damaging 1.00
R5656:Tenm3 UTSW 8 48228762 missense probably damaging 1.00
R5931:Tenm3 UTSW 8 48646498 missense probably benign 0.00
R5959:Tenm3 UTSW 8 48646447 nonsense probably null
R5965:Tenm3 UTSW 8 48228508 nonsense probably null
R6062:Tenm3 UTSW 8 48343406 missense possibly damaging 0.46
R6151:Tenm3 UTSW 8 48395573 missense probably damaging 1.00
R6157:Tenm3 UTSW 8 48298808 missense probably damaging 0.96
R6167:Tenm3 UTSW 8 48254622 missense possibly damaging 0.46
R6217:Tenm3 UTSW 8 48293665 missense probably damaging 0.99
R6233:Tenm3 UTSW 8 48417059 missense probably damaging 1.00
R6270:Tenm3 UTSW 8 48367394 missense probably damaging 0.98
R6329:Tenm3 UTSW 8 48276849 missense probably damaging 0.99
R6466:Tenm3 UTSW 8 48236063 missense probably damaging 0.97
R6515:Tenm3 UTSW 8 48417222 missense probably benign
R6516:Tenm3 UTSW 8 48417222 missense probably benign
R6747:Tenm3 UTSW 8 48343243 missense probably damaging 1.00
R6782:Tenm3 UTSW 8 48646256 critical splice donor site probably null
R6788:Tenm3 UTSW 8 48674493 missense probably damaging 1.00
R6823:Tenm3 UTSW 8 48256837 missense probably damaging 0.99
R6846:Tenm3 UTSW 8 48276738 missense probably benign 0.39
R6913:Tenm3 UTSW 8 48298937 missense probably damaging 0.99
R6941:Tenm3 UTSW 8 48674416 missense probably damaging 0.99
R6950:Tenm3 UTSW 8 48240479 nonsense probably null
R6968:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R6970:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R6993:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R7003:Tenm3 UTSW 8 48240444 missense probably damaging 1.00
R7125:Tenm3 UTSW 8 48674553 missense probably benign 0.00
R7140:Tenm3 UTSW 8 48292236 missense probably damaging 1.00
R7222:Tenm3 UTSW 8 48300969 missense probably damaging 1.00
R7232:Tenm3 UTSW 8 48235935 missense probably damaging 1.00
R7336:Tenm3 UTSW 8 48236177 missense possibly damaging 0.93
R7417:Tenm3 UTSW 8 48236183 missense probably damaging 1.00
R7526:Tenm3 UTSW 8 48287812 missense probably damaging 0.96
R7527:Tenm3 UTSW 8 48276600 missense possibly damaging 0.60
R7616:Tenm3 UTSW 8 48341049 missense possibly damaging 0.56
R7662:Tenm3 UTSW 8 48335727 missense probably benign 0.27
R7734:Tenm3 UTSW 8 48646333 missense probably damaging 1.00
R7802:Tenm3 UTSW 8 48236465 missense probably damaging 1.00
R7812:Tenm3 UTSW 8 48276300 missense probably benign 0.01
R7843:Tenm3 UTSW 8 48229111 nonsense probably null
R7951:Tenm3 UTSW 8 48310703 missense possibly damaging 0.86
R8293:Tenm3 UTSW 8 48367422 missense possibly damaging 0.91
R8336:Tenm3 UTSW 8 48293773 missense probably damaging 1.00
R8351:Tenm3 UTSW 8 48287872 missense probably damaging 0.96
R8387:Tenm3 UTSW 8 48287848 missense probably damaging 0.98
R8414:Tenm3 UTSW 8 48293509 missense probably damaging 1.00
R8451:Tenm3 UTSW 8 48287872 missense probably damaging 0.96
R8465:Tenm3 UTSW 8 48229181 missense probably damaging 1.00
R8528:Tenm3 UTSW 8 48342633 missense probably damaging 1.00
R8717:Tenm3 UTSW 8 48299645 missense possibly damaging 0.77
R8734:Tenm3 UTSW 8 48349356 missense probably benign 0.16
R8781:Tenm3 UTSW 8 48342449 frame shift probably null
R8820:Tenm3 UTSW 8 48310724 missense probably damaging 0.96
R8831:Tenm3 UTSW 8 48276382 missense
R8853:Tenm3 UTSW 8 48342347 missense probably damaging 1.00
X0010:Tenm3 UTSW 8 48287829 missense probably damaging 0.98
X0025:Tenm3 UTSW 8 48236477 missense probably damaging 1.00
Z1177:Tenm3 UTSW 8 48276780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATCAGGAGACACCACCCG -3'
(R):5'- ATGTGACTGCAAGAACGACG -3'

Sequencing Primer
(F):5'- AGACACCACCCGCACCG -3'
(R):5'- GACGCCAACTGTGACTGCTAC -3'
Posted On2021-04-30