Incidental Mutation 'R8821:Tenm3'
ID 673047
Institutional Source Beutler Lab
Gene Symbol Tenm3
Ensembl Gene ENSMUSG00000031561
Gene Name teneurin transmembrane protein 3
Synonyms Ten-m3, Odz3, 2610100B16Rik
MMRRC Submission 068654-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.598) question?
Stock # R8821 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 48227682-48843951 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 48276382 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 1530 (A1530T)
Ref Sequence ENSEMBL: ENSMUSP00000033965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000190840]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561
AA Change: A1530T

DomainStartEndE-ValueType
Pfam:Ten_N 11 177 6.9e-91 PFAM
Pfam:Ten_N 171 308 1e-72 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2631 2708 1.5e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190840
AA Change: A1514T

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561
AA Change: A1514T

DomainStartEndE-ValueType
Pfam:Ten_N 10 182 7.6e-77 PFAM
Pfam:Ten_N 168 308 6.6e-50 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2630 2708 3.2e-35 PFAM
Meta Mutation Damage Score 0.2601 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A T 5: 109,676,308 (GRCm38) S425R probably benign Het
A230072I06Rik A T 8: 12,279,688 (GRCm38) I48L unknown Het
Abca8a A T 11: 110,058,536 (GRCm38) I927K probably damaging Het
Abcc3 A C 11: 94,350,961 (GRCm38) C1415G probably damaging Het
Abcf3 C T 16: 20,550,464 (GRCm38) R205C probably damaging Het
Aldh3a1 A G 11: 61,216,316 (GRCm38) Y282C probably damaging Het
Alyref CCCGCGCGGCGGCCTGCACTGCGCCGCCGCGGCCGCCCTGGGAGCCGGCCCTGCCGCG CCCGCG 11: 120,598,197 (GRCm38) probably null Het
Arfgef3 A G 10: 18,652,743 (GRCm38) S299P possibly damaging Het
Asic2 A T 11: 81,967,900 (GRCm38) N95K probably damaging Het
Atp2c2 A G 8: 119,749,294 (GRCm38) probably null Het
Btbd18 A G 2: 84,667,257 (GRCm38) D413G probably damaging Het
C8b A G 4: 104,790,677 (GRCm38) Y355C probably damaging Het
Carm1 A G 9: 21,580,367 (GRCm38) E244G probably damaging Het
Catsperg1 A T 7: 29,204,936 (GRCm38) probably benign Het
Cish T A 9: 107,300,472 (GRCm38) F116I probably damaging Het
Ckmt1 G A 2: 121,360,821 (GRCm38) probably benign Het
Clasrp C T 7: 19,586,437 (GRCm38) R432H unknown Het
Clstn1 G A 4: 149,646,323 (GRCm38) R837Q probably benign Het
Col27a1 A G 4: 63,224,911 (GRCm38) T279A probably benign Het
Cox10 A G 11: 63,964,480 (GRCm38) F325S probably damaging Het
Cpne5 T C 17: 29,211,694 (GRCm38) I81V probably benign Het
Ctps A T 4: 120,567,310 (GRCm38) S36T possibly damaging Het
Dchs2 T C 3: 83,285,363 (GRCm38) L1705P probably benign Het
Dcstamp A G 15: 39,754,789 (GRCm38) H198R probably benign Het
Dhx58 T A 11: 100,703,980 (GRCm38) K30M probably damaging Het
Dnah1 C T 14: 31,296,498 (GRCm38) A1392T probably benign Het
Dnah14 C A 1: 181,792,004 (GRCm38) Y3964* probably null Het
Dnah8 T C 17: 30,794,738 (GRCm38) S3818P probably damaging Het
Dnmt3b T A 2: 153,676,814 (GRCm38) N632K probably benign Het
Drc7 G A 8: 95,062,217 (GRCm38) R301Q probably damaging Het
Dsg1a T C 18: 20,320,308 (GRCm38) V21A probably damaging Het
Dtd1 T C 2: 144,617,341 (GRCm38) L95P probably benign Het
Efhb A T 17: 53,400,744 (GRCm38) probably benign Het
Fam186b T A 15: 99,280,852 (GRCm38) M198L possibly damaging Het
Fam193a A G 5: 34,459,030 (GRCm38) T850A probably benign Het
Fan1 G A 7: 64,354,501 (GRCm38) P739L probably damaging Het
Flii A T 11: 60,725,248 (GRCm38) N28K probably benign Het
Fmo3 T C 1: 162,968,838 (GRCm38) Y55C probably damaging Het
Gatsl2 T A 5: 134,135,253 (GRCm38) V96E possibly damaging Het
Gfi1 G A 5: 107,720,272 (GRCm38) R377C probably damaging Het
Gm10093 T A 17: 78,492,540 (GRCm38) L320Q probably damaging Het
Gm4450 A T 3: 98,446,731 (GRCm38) W151R probably benign Het
Gm884 A T 11: 103,619,644 (GRCm38) D499E unknown Het
Gm9195 C T 14: 72,480,096 (GRCm38) E266K possibly damaging Het
Helz A T 11: 107,635,093 (GRCm38) M825L probably damaging Het
Ift80 G A 3: 68,962,250 (GRCm38) A236V probably damaging Het
Il1rn A T 2: 24,349,493 (GRCm38) T134S possibly damaging Het
Imp4 T C 1: 34,444,364 (GRCm38) M257T probably benign Het
Impdh2 T C 9: 108,564,758 (GRCm38) L377S probably damaging Het
Kcnrg T C 14: 61,607,532 (GRCm38) V7A possibly damaging Het
Kdm1b C A 13: 47,064,141 (GRCm38) L359I possibly damaging Het
Lima1 T A 15: 99,806,425 (GRCm38) T288S probably benign Het
Lrrc4c A T 2: 97,629,695 (GRCm38) D222V possibly damaging Het
Mybpc3 T A 2: 91,118,179 (GRCm38) V4E probably null Het
Ncor1 A T 11: 62,369,408 (GRCm38) D505E probably benign Het
Nell1 A G 7: 50,826,349 (GRCm38) S579G probably damaging Het
Npc1 T A 18: 12,200,820 (GRCm38) M735L probably benign Het
Olfr1246 A G 2: 89,590,536 (GRCm38) I193T probably damaging Het
Olfr341 G A 2: 36,479,782 (GRCm38) T116I possibly damaging Het
Olfr520 A G 7: 99,735,686 (GRCm38) H181R possibly damaging Het
Pcdhb12 A G 18: 37,437,333 (GRCm38) M511V probably benign Het
Peli2 G A 14: 48,252,673 (GRCm38) E201K possibly damaging Het
Phf3 T A 1: 30,821,266 (GRCm38) K828* probably null Het
Pih1d1 A G 7: 45,156,772 (GRCm38) D44G possibly damaging Het
Prag1 A T 8: 36,146,737 (GRCm38) T1148S probably benign Het
Ptpn18 A T 1: 34,472,190 (GRCm38) R338W probably null Het
Slc7a6os A T 8: 106,210,557 (GRCm38) D90E probably benign Het
Sp7 T A 15: 102,358,792 (GRCm38) H211L possibly damaging Het
Ssh3 A G 19: 4,269,025 (GRCm38) V19A possibly damaging Het
Tcp11l2 A G 10: 84,613,658 (GRCm38) I496V probably damaging Het
Tmem232 A G 17: 65,436,372 (GRCm38) L308P probably damaging Het
Tulp4 A G 17: 6,139,134 (GRCm38) N77S probably damaging Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 (GRCm38) probably benign Het
Usp48 A T 4: 137,613,769 (GRCm38) D360V probably damaging Het
Vmn2r84 G A 10: 130,391,099 (GRCm38) A290V probably benign Het
Zfp512b T C 2: 181,586,732 (GRCm38) N738S probably benign Het
Other mutations in Tenm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Tenm3 APN 8 48,417,060 (GRCm38) missense probably damaging 1.00
IGL00538:Tenm3 APN 8 48,236,025 (GRCm38) missense probably damaging 1.00
IGL00719:Tenm3 APN 8 48,279,042 (GRCm38) missense probably benign 0.39
IGL00720:Tenm3 APN 8 48,276,421 (GRCm38) missense probably damaging 0.98
IGL00870:Tenm3 APN 8 48,417,132 (GRCm38) missense probably benign 0.00
IGL00976:Tenm3 APN 8 48,256,841 (GRCm38) missense probably benign 0.14
IGL01469:Tenm3 APN 8 48,236,423 (GRCm38) missense probably damaging 1.00
IGL01508:Tenm3 APN 8 48,276,645 (GRCm38) missense probably benign 0.09
IGL01590:Tenm3 APN 8 48,228,802 (GRCm38) missense probably damaging 1.00
IGL01610:Tenm3 APN 8 48,254,477 (GRCm38) missense probably damaging 1.00
IGL01874:Tenm3 APN 8 48,236,758 (GRCm38) nonsense probably null
IGL01892:Tenm3 APN 8 48,276,396 (GRCm38) missense probably benign 0.09
IGL02098:Tenm3 APN 8 48,276,576 (GRCm38) missense possibly damaging 0.94
IGL02382:Tenm3 APN 8 48,235,476 (GRCm38) missense probably damaging 1.00
IGL02397:Tenm3 APN 8 48,236,694 (GRCm38) missense possibly damaging 0.94
IGL02475:Tenm3 APN 8 48,279,198 (GRCm38) splice site probably benign
IGL02502:Tenm3 APN 8 48,288,016 (GRCm38) missense probably damaging 1.00
IGL02508:Tenm3 APN 8 48,299,639 (GRCm38) missense probably benign 0.30
IGL02543:Tenm3 APN 8 48,298,956 (GRCm38) missense probably damaging 1.00
IGL02723:Tenm3 APN 8 48,276,903 (GRCm38) missense probably benign 0.02
IGL03037:Tenm3 APN 8 48,298,878 (GRCm38) missense possibly damaging 0.90
IGL03160:Tenm3 APN 8 48,646,418 (GRCm38) missense probably benign 0.05
IGL03268:Tenm3 APN 8 48,235,523 (GRCm38) missense probably damaging 1.00
IGL02988:Tenm3 UTSW 8 48,235,346 (GRCm38) missense probably damaging 0.99
PIT4431001:Tenm3 UTSW 8 48,235,607 (GRCm38) missense probably damaging 1.00
PIT4504001:Tenm3 UTSW 8 48,293,657 (GRCm38) missense probably damaging 1.00
R0079:Tenm3 UTSW 8 48,343,345 (GRCm38) missense possibly damaging 0.90
R0121:Tenm3 UTSW 8 48,342,659 (GRCm38) missense probably damaging 0.99
R0123:Tenm3 UTSW 8 48,674,472 (GRCm38) missense probably damaging 1.00
R0134:Tenm3 UTSW 8 48,674,472 (GRCm38) missense probably damaging 1.00
R0147:Tenm3 UTSW 8 48,236,720 (GRCm38) missense probably damaging 1.00
R0148:Tenm3 UTSW 8 48,236,720 (GRCm38) missense probably damaging 1.00
R0309:Tenm3 UTSW 8 48,341,034 (GRCm38) missense probably damaging 1.00
R0322:Tenm3 UTSW 8 48,236,912 (GRCm38) splice site probably benign
R0335:Tenm3 UTSW 8 48,232,105 (GRCm38) missense probably damaging 1.00
R0355:Tenm3 UTSW 8 48,228,975 (GRCm38) missense probably damaging 1.00
R0411:Tenm3 UTSW 8 48,287,791 (GRCm38) missense possibly damaging 0.61
R0505:Tenm3 UTSW 8 48,341,160 (GRCm38) splice site probably benign
R0573:Tenm3 UTSW 8 48,674,399 (GRCm38) splice site probably benign
R0599:Tenm3 UTSW 8 48,277,710 (GRCm38) missense probably damaging 1.00
R0616:Tenm3 UTSW 8 48,276,156 (GRCm38) missense possibly damaging 0.76
R0637:Tenm3 UTSW 8 48,236,525 (GRCm38) missense probably damaging 1.00
R0726:Tenm3 UTSW 8 48,236,594 (GRCm38) missense probably damaging 1.00
R0840:Tenm3 UTSW 8 48,335,742 (GRCm38) missense probably damaging 0.99
R0981:Tenm3 UTSW 8 48,298,965 (GRCm38) missense probably damaging 1.00
R1006:Tenm3 UTSW 8 48,228,542 (GRCm38) missense probably damaging 1.00
R1199:Tenm3 UTSW 8 48,235,582 (GRCm38) missense probably damaging 0.99
R1223:Tenm3 UTSW 8 48,240,396 (GRCm38) missense possibly damaging 0.72
R1240:Tenm3 UTSW 8 48,287,893 (GRCm38) missense possibly damaging 0.74
R1394:Tenm3 UTSW 8 48,276,400 (GRCm38) missense probably benign
R1455:Tenm3 UTSW 8 48,279,048 (GRCm38) missense possibly damaging 0.87
R1459:Tenm3 UTSW 8 48,235,971 (GRCm38) missense probably damaging 1.00
R1473:Tenm3 UTSW 8 48,310,625 (GRCm38) missense probably damaging 1.00
R1501:Tenm3 UTSW 8 48,343,316 (GRCm38) missense probably damaging 0.99
R1507:Tenm3 UTSW 8 48,287,822 (GRCm38) missense probably benign 0.01
R1522:Tenm3 UTSW 8 48,395,576 (GRCm38) missense probably damaging 1.00
R1524:Tenm3 UTSW 8 48,228,981 (GRCm38) missense possibly damaging 0.92
R1553:Tenm3 UTSW 8 48,236,421 (GRCm38) missense probably damaging 1.00
R1572:Tenm3 UTSW 8 48,228,993 (GRCm38) missense possibly damaging 0.94
R1583:Tenm3 UTSW 8 48,279,074 (GRCm38) missense probably benign 0.09
R1676:Tenm3 UTSW 8 48,417,119 (GRCm38) missense possibly damaging 0.83
R1732:Tenm3 UTSW 8 48,310,634 (GRCm38) missense probably damaging 1.00
R1768:Tenm3 UTSW 8 48,232,104 (GRCm38) missense probably damaging 1.00
R1777:Tenm3 UTSW 8 48,417,179 (GRCm38) missense probably benign 0.05
R1793:Tenm3 UTSW 8 48,674,544 (GRCm38) missense probably damaging 0.98
R1801:Tenm3 UTSW 8 48,276,256 (GRCm38) missense probably benign 0.39
R1863:Tenm3 UTSW 8 48,276,346 (GRCm38) missense probably benign 0.20
R1898:Tenm3 UTSW 8 48,310,761 (GRCm38) missense probably damaging 1.00
R1971:Tenm3 UTSW 8 48,236,313 (GRCm38) missense probably damaging 1.00
R1972:Tenm3 UTSW 8 48,228,591 (GRCm38) missense probably damaging 1.00
R1996:Tenm3 UTSW 8 48,228,668 (GRCm38) missense probably damaging 1.00
R2061:Tenm3 UTSW 8 48,342,256 (GRCm38) critical splice donor site probably null
R2109:Tenm3 UTSW 8 48,343,349 (GRCm38) missense possibly damaging 0.94
R2124:Tenm3 UTSW 8 48,417,006 (GRCm38) critical splice donor site probably null
R2190:Tenm3 UTSW 8 48,395,544 (GRCm38) missense probably damaging 1.00
R2204:Tenm3 UTSW 8 48,674,550 (GRCm38) missense probably benign 0.17
R2233:Tenm3 UTSW 8 48,276,169 (GRCm38) missense probably benign 0.04
R2234:Tenm3 UTSW 8 48,276,169 (GRCm38) missense probably benign 0.04
R2235:Tenm3 UTSW 8 48,276,169 (GRCm38) missense probably benign 0.04
R2237:Tenm3 UTSW 8 48,342,337 (GRCm38) missense probably damaging 1.00
R2418:Tenm3 UTSW 8 48,276,658 (GRCm38) missense possibly damaging 0.87
R2419:Tenm3 UTSW 8 48,276,658 (GRCm38) missense possibly damaging 0.87
R2435:Tenm3 UTSW 8 48,287,953 (GRCm38) missense probably damaging 1.00
R2483:Tenm3 UTSW 8 48,240,270 (GRCm38) missense probably damaging 0.99
R3406:Tenm3 UTSW 8 48,228,555 (GRCm38) missense probably damaging 1.00
R3724:Tenm3 UTSW 8 48,277,746 (GRCm38) missense probably damaging 0.97
R4009:Tenm3 UTSW 8 48,349,223 (GRCm38) missense probably damaging 1.00
R4210:Tenm3 UTSW 8 48,349,404 (GRCm38) missense probably damaging 1.00
R4293:Tenm3 UTSW 8 48,395,658 (GRCm38) missense probably damaging 1.00
R4656:Tenm3 UTSW 8 48,293,726 (GRCm38) missense probably damaging 1.00
R4663:Tenm3 UTSW 8 48,235,970 (GRCm38) missense probably damaging 1.00
R4835:Tenm3 UTSW 8 48,313,236 (GRCm38) critical splice donor site probably null
R4851:Tenm3 UTSW 8 48,310,621 (GRCm38) critical splice donor site probably null
R4867:Tenm3 UTSW 8 48,235,821 (GRCm38) missense probably damaging 1.00
R4892:Tenm3 UTSW 8 48,276,861 (GRCm38) missense probably damaging 0.99
R4895:Tenm3 UTSW 8 48,300,971 (GRCm38) missense probably damaging 1.00
R4962:Tenm3 UTSW 8 48,278,961 (GRCm38) nonsense probably null
R4995:Tenm3 UTSW 8 48,229,137 (GRCm38) missense possibly damaging 0.87
R4996:Tenm3 UTSW 8 48,235,826 (GRCm38) missense probably damaging 0.97
R5091:Tenm3 UTSW 8 48,342,308 (GRCm38) missense probably benign 0.14
R5228:Tenm3 UTSW 8 48,236,355 (GRCm38) missense probably damaging 1.00
R5253:Tenm3 UTSW 8 48,229,198 (GRCm38) missense possibly damaging 0.92
R5260:Tenm3 UTSW 8 48,236,855 (GRCm38) missense probably damaging 1.00
R5363:Tenm3 UTSW 8 48,287,831 (GRCm38) missense possibly damaging 0.55
R5414:Tenm3 UTSW 8 48,236,355 (GRCm38) missense probably damaging 1.00
R5427:Tenm3 UTSW 8 48,236,564 (GRCm38) missense probably damaging 1.00
R5431:Tenm3 UTSW 8 48,367,377 (GRCm38) nonsense probably null
R5566:Tenm3 UTSW 8 48,279,006 (GRCm38) missense probably damaging 1.00
R5579:Tenm3 UTSW 8 48,236,764 (GRCm38) missense probably damaging 1.00
R5656:Tenm3 UTSW 8 48,228,762 (GRCm38) missense probably damaging 1.00
R5931:Tenm3 UTSW 8 48,646,498 (GRCm38) missense probably benign 0.00
R5959:Tenm3 UTSW 8 48,646,447 (GRCm38) nonsense probably null
R5965:Tenm3 UTSW 8 48,228,508 (GRCm38) nonsense probably null
R6062:Tenm3 UTSW 8 48,343,406 (GRCm38) missense possibly damaging 0.46
R6151:Tenm3 UTSW 8 48,395,573 (GRCm38) missense probably damaging 1.00
R6157:Tenm3 UTSW 8 48,298,808 (GRCm38) missense probably damaging 0.96
R6167:Tenm3 UTSW 8 48,254,622 (GRCm38) missense possibly damaging 0.46
R6217:Tenm3 UTSW 8 48,293,665 (GRCm38) missense probably damaging 0.99
R6233:Tenm3 UTSW 8 48,417,059 (GRCm38) missense probably damaging 1.00
R6270:Tenm3 UTSW 8 48,367,394 (GRCm38) missense probably damaging 0.98
R6329:Tenm3 UTSW 8 48,276,849 (GRCm38) missense probably damaging 0.99
R6466:Tenm3 UTSW 8 48,236,063 (GRCm38) missense probably damaging 0.97
R6515:Tenm3 UTSW 8 48,417,222 (GRCm38) missense probably benign
R6516:Tenm3 UTSW 8 48,417,222 (GRCm38) missense probably benign
R6747:Tenm3 UTSW 8 48,343,243 (GRCm38) missense probably damaging 1.00
R6782:Tenm3 UTSW 8 48,646,256 (GRCm38) critical splice donor site probably null
R6788:Tenm3 UTSW 8 48,674,493 (GRCm38) missense probably damaging 1.00
R6823:Tenm3 UTSW 8 48,256,837 (GRCm38) missense probably damaging 0.99
R6846:Tenm3 UTSW 8 48,276,738 (GRCm38) missense probably benign 0.39
R6913:Tenm3 UTSW 8 48,298,937 (GRCm38) missense probably damaging 0.99
R6941:Tenm3 UTSW 8 48,674,416 (GRCm38) missense probably damaging 0.99
R6950:Tenm3 UTSW 8 48,240,479 (GRCm38) nonsense probably null
R6968:Tenm3 UTSW 8 48,236,439 (GRCm38) missense probably damaging 1.00
R6970:Tenm3 UTSW 8 48,236,439 (GRCm38) missense probably damaging 1.00
R6993:Tenm3 UTSW 8 48,236,439 (GRCm38) missense probably damaging 1.00
R7003:Tenm3 UTSW 8 48,240,444 (GRCm38) missense probably damaging 1.00
R7125:Tenm3 UTSW 8 48,674,553 (GRCm38) missense probably benign 0.00
R7140:Tenm3 UTSW 8 48,292,236 (GRCm38) missense probably damaging 1.00
R7222:Tenm3 UTSW 8 48,300,969 (GRCm38) missense probably damaging 1.00
R7232:Tenm3 UTSW 8 48,235,935 (GRCm38) missense probably damaging 1.00
R7336:Tenm3 UTSW 8 48,236,177 (GRCm38) missense possibly damaging 0.93
R7417:Tenm3 UTSW 8 48,236,183 (GRCm38) missense probably damaging 1.00
R7526:Tenm3 UTSW 8 48,287,812 (GRCm38) missense probably damaging 0.96
R7527:Tenm3 UTSW 8 48,276,600 (GRCm38) missense possibly damaging 0.60
R7616:Tenm3 UTSW 8 48,341,049 (GRCm38) missense possibly damaging 0.56
R7662:Tenm3 UTSW 8 48,335,727 (GRCm38) missense probably benign 0.27
R7734:Tenm3 UTSW 8 48,646,333 (GRCm38) missense probably damaging 1.00
R7802:Tenm3 UTSW 8 48,236,465 (GRCm38) missense probably damaging 1.00
R7812:Tenm3 UTSW 8 48,276,300 (GRCm38) missense probably benign 0.01
R7843:Tenm3 UTSW 8 48,229,111 (GRCm38) nonsense probably null
R7951:Tenm3 UTSW 8 48,310,703 (GRCm38) missense possibly damaging 0.86
R8293:Tenm3 UTSW 8 48,367,422 (GRCm38) missense possibly damaging 0.91
R8336:Tenm3 UTSW 8 48,293,773 (GRCm38) missense probably damaging 1.00
R8351:Tenm3 UTSW 8 48,287,872 (GRCm38) missense probably damaging 0.96
R8387:Tenm3 UTSW 8 48,287,848 (GRCm38) missense probably damaging 0.98
R8414:Tenm3 UTSW 8 48,293,509 (GRCm38) missense probably damaging 1.00
R8451:Tenm3 UTSW 8 48,287,872 (GRCm38) missense probably damaging 0.96
R8465:Tenm3 UTSW 8 48,229,181 (GRCm38) missense probably damaging 1.00
R8528:Tenm3 UTSW 8 48,342,633 (GRCm38) missense probably damaging 1.00
R8717:Tenm3 UTSW 8 48,299,645 (GRCm38) missense possibly damaging 0.77
R8734:Tenm3 UTSW 8 48,349,356 (GRCm38) missense probably benign 0.16
R8781:Tenm3 UTSW 8 48,342,449 (GRCm38) frame shift probably null
R8820:Tenm3 UTSW 8 48,310,724 (GRCm38) missense probably damaging 0.96
R8831:Tenm3 UTSW 8 48,276,382 (GRCm38) missense
R8853:Tenm3 UTSW 8 48,342,347 (GRCm38) missense probably damaging 1.00
R8900:Tenm3 UTSW 8 48,236,402 (GRCm38) missense probably damaging 1.00
R8931:Tenm3 UTSW 8 48,235,602 (GRCm38) missense probably damaging 1.00
R8933:Tenm3 UTSW 8 48,279,060 (GRCm38) missense possibly damaging 0.53
R8989:Tenm3 UTSW 8 48,235,348 (GRCm38) nonsense probably null
R8998:Tenm3 UTSW 8 48,276,687 (GRCm38) missense probably damaging 1.00
R9008:Tenm3 UTSW 8 48,342,653 (GRCm38) missense probably damaging 0.98
R9017:Tenm3 UTSW 8 48,254,633 (GRCm38) missense probably damaging 0.99
R9101:Tenm3 UTSW 8 48,292,151 (GRCm38) missense probably damaging 1.00
R9108:Tenm3 UTSW 8 48,313,236 (GRCm38) critical splice donor site probably null
R9142:Tenm3 UTSW 8 48,335,513 (GRCm38) missense unknown
R9231:Tenm3 UTSW 8 48,236,196 (GRCm38) missense probably damaging 1.00
R9309:Tenm3 UTSW 8 48,298,937 (GRCm38) missense probably damaging 0.99
R9310:Tenm3 UTSW 8 48,555,900 (GRCm38) unclassified probably benign
R9336:Tenm3 UTSW 8 48,417,080 (GRCm38) missense probably damaging 1.00
R9373:Tenm3 UTSW 8 48,299,655 (GRCm38) missense probably damaging 1.00
R9393:Tenm3 UTSW 8 48,674,524 (GRCm38) missense probably damaging 0.99
R9509:Tenm3 UTSW 8 48,313,257 (GRCm38) nonsense probably null
R9575:Tenm3 UTSW 8 48,235,761 (GRCm38) missense possibly damaging 0.94
R9698:Tenm3 UTSW 8 48,236,211 (GRCm38) missense probably damaging 1.00
R9722:Tenm3 UTSW 8 48,300,814 (GRCm38) missense probably benign 0.00
R9788:Tenm3 UTSW 8 48,335,561 (GRCm38) missense probably benign 0.02
X0010:Tenm3 UTSW 8 48,287,829 (GRCm38) missense probably damaging 0.98
X0025:Tenm3 UTSW 8 48,236,477 (GRCm38) missense probably damaging 1.00
Z1177:Tenm3 UTSW 8 48,276,780 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATCAGGAGACACCACCCG -3'
(R):5'- ATGTGACTGCAAGAACGACG -3'

Sequencing Primer
(F):5'- AGACACCACCCGCACCG -3'
(R):5'- GACGCCAACTGTGACTGCTAC -3'
Posted On 2021-04-30