Incidental Mutation 'R8821:Helz'
ID673064
Institutional Source Beutler Lab
Gene Symbol Helz
Ensembl Gene ENSMUSG00000020721
Gene Namehelicase with zinc finger domain
Synonyms9630002H22Rik, 3110078M01Rik, 9430093I07Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8821 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location107547930-107693826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107635093 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 825 (M825L)
Ref Sequence ENSEMBL: ENSMUSP00000074533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075012] [ENSMUST00000100305] [ENSMUST00000106746] [ENSMUST00000133862]
Predicted Effect probably damaging
Transcript: ENSMUST00000075012
AA Change: M825L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074533
Gene: ENSMUSG00000020721
AA Change: M825L

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:ResIII 639 807 6.7e-8 PFAM
Pfam:AAA_11 641 768 2.3e-14 PFAM
Pfam:AAA_30 641 838 2.6e-11 PFAM
Pfam:AAA_19 648 729 5.5e-11 PFAM
Pfam:AAA_11 758 834 3.8e-18 PFAM
Pfam:AAA_12 841 1053 7.4e-38 PFAM
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1360 1448 N/A INTRINSIC
low complexity region 1466 1487 N/A INTRINSIC
low complexity region 1557 1568 N/A INTRINSIC
low complexity region 1631 1647 N/A INTRINSIC
low complexity region 1716 1736 N/A INTRINSIC
low complexity region 1926 1933 N/A INTRINSIC
low complexity region 1942 1957 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100305
AA Change: M824L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097878
Gene: ENSMUSG00000020721
AA Change: M824L

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:AAA_11 641 833 2.7e-31 PFAM
Pfam:AAA_30 641 837 1.7e-10 PFAM
Pfam:AAA_19 648 727 6.3e-9 PFAM
Pfam:AAA_12 840 1052 3.4e-36 PFAM
low complexity region 1164 1175 N/A INTRINSIC
low complexity region 1359 1447 N/A INTRINSIC
low complexity region 1465 1486 N/A INTRINSIC
low complexity region 1556 1567 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106746
AA Change: M824L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102357
Gene: ENSMUSG00000020721
AA Change: M824L

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:AAA_11 641 833 1e-31 PFAM
Pfam:AAA_30 641 837 8.3e-11 PFAM
Pfam:AAA_19 648 727 2.2e-9 PFAM
Pfam:AAA_12 840 1052 1.7e-36 PFAM
low complexity region 1164 1175 N/A INTRINSIC
low complexity region 1359 1447 N/A INTRINSIC
low complexity region 1465 1486 N/A INTRINSIC
low complexity region 1556 1567 N/A INTRINSIC
low complexity region 1630 1646 N/A INTRINSIC
low complexity region 1715 1735 N/A INTRINSIC
low complexity region 1925 1932 N/A INTRINSIC
low complexity region 1941 1956 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000133862
AA Change: M143L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117498
Gene: ENSMUSG00000020721
AA Change: M143L

DomainStartEndE-ValueType
Pfam:AAA_11 68 152 2.1e-19 PFAM
Pfam:AAA_12 159 371 1.5e-36 PFAM
low complexity region 483 494 N/A INTRINSIC
low complexity region 678 766 N/A INTRINSIC
low complexity region 784 805 N/A INTRINSIC
low complexity region 875 886 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HELZ is a member of the superfamily I class of RNA helicases. RNA helicases alter the conformation of RNA by unwinding double-stranded regions, thereby altering the biologic activity of the RNA molecule and regulating access to other proteins (Wagner et al., 1999 [PubMed 10471385]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele are viable, fertile and phenotypically normal with no apparent skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A T 5: 109,676,308 S425R probably benign Het
A230072I06Rik A T 8: 12,279,688 I48L unknown Het
Abca8a A T 11: 110,058,536 I927K probably damaging Het
Abcc3 A C 11: 94,350,961 C1415G probably damaging Het
Abcf3 C T 16: 20,550,464 R205C probably damaging Het
Aldh3a1 A G 11: 61,216,316 Y282C probably damaging Het
Alyref CCCGCGCGGCGGCCTGCACTGCGCCGCCGCGGCCGCCCTGGGAGCCGGCCCTGCCGCG CCCGCG 11: 120,598,197 probably null Het
Arfgef3 A G 10: 18,652,743 S299P possibly damaging Het
Asic2 A T 11: 81,967,900 N95K probably damaging Het
Btbd18 A G 2: 84,667,257 D413G probably damaging Het
C8b A G 4: 104,790,677 Y355C probably damaging Het
Carm1 A G 9: 21,580,367 E244G probably damaging Het
Cish T A 9: 107,300,472 F116I probably damaging Het
Clasrp C T 7: 19,586,437 R432H unknown Het
Clstn1 G A 4: 149,646,323 R837Q probably benign Het
Col27a1 A G 4: 63,224,911 T279A probably benign Het
Cox10 A G 11: 63,964,480 F325S probably damaging Het
Cpne5 T C 17: 29,211,694 I81V probably benign Het
Ctps A T 4: 120,567,310 S36T possibly damaging Het
Dchs2 T C 3: 83,285,363 L1705P probably benign Het
Dcstamp A G 15: 39,754,789 H198R probably benign Het
Dhx58 T A 11: 100,703,980 K30M probably damaging Het
Dnah1 C T 14: 31,296,498 A1392T probably benign Het
Dnah14 C A 1: 181,792,004 Y3964* probably null Het
Dnah8 T C 17: 30,794,738 S3818P probably damaging Het
Dnmt3b T A 2: 153,676,814 N632K probably benign Het
Drc7 G A 8: 95,062,217 R301Q probably damaging Het
Dsg1a T C 18: 20,320,308 V21A probably damaging Het
Dtd1 T C 2: 144,617,341 L95P probably benign Het
Efhb A T 17: 53,400,744 probably benign Het
Fam186b T A 15: 99,280,852 M198L possibly damaging Het
Fam193a A G 5: 34,459,030 T850A probably benign Het
Fan1 G A 7: 64,354,501 P739L probably damaging Het
Flii A T 11: 60,725,248 N28K probably benign Het
Fmo3 T C 1: 162,968,838 Y55C probably damaging Het
Gatsl2 T A 5: 134,135,253 V96E possibly damaging Het
Gfi1 G A 5: 107,720,272 R377C probably damaging Het
Gm10093 T A 17: 78,492,540 L320Q probably damaging Het
Gm4450 A T 3: 98,446,731 W151R probably benign Het
Gm884 A T 11: 103,619,644 D499E unknown Het
Gm9195 C T 14: 72,480,096 E266K possibly damaging Het
Ift80 G A 3: 68,962,250 A236V probably damaging Het
Il1rn A T 2: 24,349,493 T134S possibly damaging Het
Imp4 T C 1: 34,444,364 M257T probably benign Het
Impdh2 T C 9: 108,564,758 L377S probably damaging Het
Kcnrg T C 14: 61,607,532 V7A possibly damaging Het
Kdm1b C A 13: 47,064,141 L359I possibly damaging Het
Lima1 T A 15: 99,806,425 T288S probably benign Het
Lrrc4c A T 2: 97,629,695 D222V possibly damaging Het
Mybpc3 T A 2: 91,118,179 V4E probably null Het
Ncor1 A T 11: 62,369,408 D505E probably benign Het
Nell1 A G 7: 50,826,349 S579G probably damaging Het
Npc1 T A 18: 12,200,820 M735L probably benign Het
Olfr1246 A G 2: 89,590,536 I193T probably damaging Het
Olfr341 G A 2: 36,479,782 T116I possibly damaging Het
Olfr520 A G 7: 99,735,686 H181R possibly damaging Het
Pcdhb12 A G 18: 37,437,333 M511V probably benign Het
Peli2 G A 14: 48,252,673 E201K possibly damaging Het
Phf3 T A 1: 30,821,266 K828* probably null Het
Pih1d1 A G 7: 45,156,772 D44G possibly damaging Het
Prag1 A T 8: 36,146,737 T1148S probably benign Het
Ptpn18 A T 1: 34,472,190 R338W probably null Het
Slc7a6os A T 8: 106,210,557 D90E probably benign Het
Sp7 T A 15: 102,358,792 H211L possibly damaging Het
Ssh3 A G 19: 4,269,025 V19A possibly damaging Het
Tcp11l2 A G 10: 84,613,658 I496V probably damaging Het
Tenm3 C T 8: 48,276,382 A1530T Het
Tmem232 A G 17: 65,436,372 L308P probably damaging Het
Tulp4 A G 17: 6,139,134 N77S probably damaging Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Usp48 A T 4: 137,613,769 D360V probably damaging Het
Vmn2r84 G A 10: 130,391,099 A290V probably benign Het
Zfp512b T C 2: 181,586,732 N738S probably benign Het
Other mutations in Helz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Helz APN 11 107663653 missense possibly damaging 0.90
IGL01419:Helz APN 11 107686514 missense unknown
IGL01864:Helz APN 11 107602354 missense probably damaging 0.98
IGL01999:Helz APN 11 107602928 splice site probably benign
IGL02938:Helz APN 11 107686438 missense unknown
IGL03157:Helz APN 11 107577888 missense possibly damaging 0.95
IGL03374:Helz APN 11 107620147 missense probably damaging 0.98
R0058:Helz UTSW 11 107672558 unclassified probably benign
R0058:Helz UTSW 11 107672558 unclassified probably benign
R0112:Helz UTSW 11 107672948 unclassified probably benign
R0243:Helz UTSW 11 107637914 missense possibly damaging 0.85
R0328:Helz UTSW 11 107604348 missense probably benign 0.30
R0578:Helz UTSW 11 107686400 missense unknown
R0928:Helz UTSW 11 107626693 missense probably damaging 0.99
R1428:Helz UTSW 11 107592840 splice site probably benign
R1493:Helz UTSW 11 107613925 missense probably benign 0.15
R1494:Helz UTSW 11 107604063 splice site probably benign
R1541:Helz UTSW 11 107670048 missense probably benign 0.39
R1619:Helz UTSW 11 107636279 nonsense probably null
R1809:Helz UTSW 11 107599171 missense possibly damaging 0.87
R1942:Helz UTSW 11 107602492 missense probably benign 0.20
R2095:Helz UTSW 11 107646146 missense probably damaging 1.00
R2133:Helz UTSW 11 107670484 missense unknown
R2167:Helz UTSW 11 107672964 unclassified probably benign
R2406:Helz UTSW 11 107686552 missense unknown
R2571:Helz UTSW 11 107613952 missense probably benign 0.05
R2858:Helz UTSW 11 107672927 unclassified probably benign
R3927:Helz UTSW 11 107685292 missense unknown
R4449:Helz UTSW 11 107604163 missense probably benign 0.01
R4453:Helz UTSW 11 107672629 nonsense probably null
R4583:Helz UTSW 11 107646069 missense probably damaging 1.00
R4684:Helz UTSW 11 107649145 missense probably damaging 1.00
R4714:Helz UTSW 11 107626716 critical splice donor site probably null
R4875:Helz UTSW 11 107637734 intron probably benign
R4924:Helz UTSW 11 107602339 missense probably damaging 1.00
R4930:Helz UTSW 11 107620168 missense probably damaging 0.99
R5078:Helz UTSW 11 107656096 missense probably damaging 1.00
R5446:Helz UTSW 11 107632204 missense probably damaging 1.00
R5535:Helz UTSW 11 107646120 missense probably damaging 0.98
R5650:Helz UTSW 11 107595146 missense probably null 0.96
R5714:Helz UTSW 11 107626521 splice site probably null
R5784:Helz UTSW 11 107670481 missense unknown
R5998:Helz UTSW 11 107685534 nonsense probably null
R6042:Helz UTSW 11 107614120 critical splice donor site probably null
R6089:Helz UTSW 11 107595137 critical splice acceptor site probably null
R6137:Helz UTSW 11 107619060 missense possibly damaging 0.83
R6373:Helz UTSW 11 107595184 missense probably benign 0.01
R6392:Helz UTSW 11 107602341 missense possibly damaging 0.80
R6618:Helz UTSW 11 107599150 missense probably benign 0.01
R6644:Helz UTSW 11 107632261 missense possibly damaging 0.74
R6811:Helz UTSW 11 107619318 critical splice donor site probably null
R6874:Helz UTSW 11 107663634 missense probably damaging 0.97
R6911:Helz UTSW 11 107619225 missense probably benign 0.01
R7039:Helz UTSW 11 107619318 critical splice donor site probably null
R7061:Helz UTSW 11 107649177 missense possibly damaging 0.83
R7438:Helz UTSW 11 107662030 missense probably damaging 0.98
R7464:Helz UTSW 11 107636278 missense probably damaging 1.00
R7513:Helz UTSW 11 107656115 missense probably damaging 0.99
R7559:Helz UTSW 11 107600278 missense possibly damaging 0.67
R7734:Helz UTSW 11 107685422 missense unknown
R7780:Helz UTSW 11 107637863 missense probably damaging 1.00
R7982:Helz UTSW 11 107626630 missense possibly damaging 0.84
R8024:Helz UTSW 11 107686421 missense unknown
R8181:Helz UTSW 11 107672573 missense unknown
R8346:Helz UTSW 11 107672573 missense unknown
R8729:Helz UTSW 11 107637928 critical splice donor site probably null
R8807:Helz UTSW 11 107603009 missense probably damaging 1.00
R8891:Helz UTSW 11 107662016 missense probably damaging 0.99
R8909:Helz UTSW 11 107666008 missense possibly damaging 0.94
R8922:Helz UTSW 11 107649159 missense possibly damaging 0.90
R8926:Helz UTSW 11 107672683 missense unknown
X0065:Helz UTSW 11 107670447 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGCCTTAGACTATTCATGACTTGG -3'
(R):5'- GGCTTTCTTCCATAATGAAACCCAC -3'

Sequencing Primer
(F):5'- TGAAACAAACTTTACCTAGCAGCG -3'
(R):5'- TTCTTCCATAATGAAACCCACTACTC -3'
Posted On2021-04-30