Incidental Mutation 'R8821:Gm10093'
ID 673083
Institutional Source Beutler Lab
Gene Symbol Gm10093
Ensembl Gene ENSMUSG00000061062
Gene Name predicted pseudogene 10093
Synonyms EG15181
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.754) question?
Stock # R8821 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 78491565-78493541 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 78492540 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 320 (L320Q)
Ref Sequence ENSEMBL: ENSMUSP00000078339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079363]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000079363
AA Change: L320Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078339
Gene: ENSMUSG00000061062
AA Change: L320Q

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 18 320 3.2e-84 PFAM
low complexity region 390 402 N/A INTRINSIC
low complexity region 417 430 N/A INTRINSIC
low complexity region 443 471 N/A INTRINSIC
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A T 5: 109,676,308 S425R probably benign Het
A230072I06Rik A T 8: 12,279,688 I48L unknown Het
Abca8a A T 11: 110,058,536 I927K probably damaging Het
Abcc3 A C 11: 94,350,961 C1415G probably damaging Het
Abcf3 C T 16: 20,550,464 R205C probably damaging Het
Aldh3a1 A G 11: 61,216,316 Y282C probably damaging Het
Alyref CCCGCGCGGCGGCCTGCACTGCGCCGCCGCGGCCGCCCTGGGAGCCGGCCCTGCCGCG CCCGCG 11: 120,598,197 probably null Het
Arfgef3 A G 10: 18,652,743 S299P possibly damaging Het
Asic2 A T 11: 81,967,900 N95K probably damaging Het
Atp2c2 A G 8: 119,749,294 probably null Het
Btbd18 A G 2: 84,667,257 D413G probably damaging Het
C8b A G 4: 104,790,677 Y355C probably damaging Het
Carm1 A G 9: 21,580,367 E244G probably damaging Het
Catsperg1 A T 7: 29,204,936 probably benign Het
Cish T A 9: 107,300,472 F116I probably damaging Het
Ckmt1 G A 2: 121,360,821 probably benign Het
Clasrp C T 7: 19,586,437 R432H unknown Het
Clstn1 G A 4: 149,646,323 R837Q probably benign Het
Col27a1 A G 4: 63,224,911 T279A probably benign Het
Cox10 A G 11: 63,964,480 F325S probably damaging Het
Cpne5 T C 17: 29,211,694 I81V probably benign Het
Ctps A T 4: 120,567,310 S36T possibly damaging Het
Dchs2 T C 3: 83,285,363 L1705P probably benign Het
Dcstamp A G 15: 39,754,789 H198R probably benign Het
Dhx58 T A 11: 100,703,980 K30M probably damaging Het
Dnah1 C T 14: 31,296,498 A1392T probably benign Het
Dnah14 C A 1: 181,792,004 Y3964* probably null Het
Dnah8 T C 17: 30,794,738 S3818P probably damaging Het
Dnmt3b T A 2: 153,676,814 N632K probably benign Het
Drc7 G A 8: 95,062,217 R301Q probably damaging Het
Dsg1a T C 18: 20,320,308 V21A probably damaging Het
Dtd1 T C 2: 144,617,341 L95P probably benign Het
Efhb A T 17: 53,400,744 probably benign Het
Fam186b T A 15: 99,280,852 M198L possibly damaging Het
Fam193a A G 5: 34,459,030 T850A probably benign Het
Fan1 G A 7: 64,354,501 P739L probably damaging Het
Flii A T 11: 60,725,248 N28K probably benign Het
Fmo3 T C 1: 162,968,838 Y55C probably damaging Het
Gatsl2 T A 5: 134,135,253 V96E possibly damaging Het
Gfi1 G A 5: 107,720,272 R377C probably damaging Het
Gm4450 A T 3: 98,446,731 W151R probably benign Het
Gm884 A T 11: 103,619,644 D499E unknown Het
Gm9195 C T 14: 72,480,096 E266K possibly damaging Het
Helz A T 11: 107,635,093 M825L probably damaging Het
Ift80 G A 3: 68,962,250 A236V probably damaging Het
Il1rn A T 2: 24,349,493 T134S possibly damaging Het
Imp4 T C 1: 34,444,364 M257T probably benign Het
Impdh2 T C 9: 108,564,758 L377S probably damaging Het
Kcnrg T C 14: 61,607,532 V7A possibly damaging Het
Kdm1b C A 13: 47,064,141 L359I possibly damaging Het
Lima1 T A 15: 99,806,425 T288S probably benign Het
Lrrc4c A T 2: 97,629,695 D222V possibly damaging Het
Mybpc3 T A 2: 91,118,179 V4E probably null Het
Ncor1 A T 11: 62,369,408 D505E probably benign Het
Nell1 A G 7: 50,826,349 S579G probably damaging Het
Npc1 T A 18: 12,200,820 M735L probably benign Het
Olfr1246 A G 2: 89,590,536 I193T probably damaging Het
Olfr341 G A 2: 36,479,782 T116I possibly damaging Het
Olfr520 A G 7: 99,735,686 H181R possibly damaging Het
Pcdhb12 A G 18: 37,437,333 M511V probably benign Het
Peli2 G A 14: 48,252,673 E201K possibly damaging Het
Phf3 T A 1: 30,821,266 K828* probably null Het
Pih1d1 A G 7: 45,156,772 D44G possibly damaging Het
Prag1 A T 8: 36,146,737 T1148S probably benign Het
Ptpn18 A T 1: 34,472,190 R338W probably null Het
Slc7a6os A T 8: 106,210,557 D90E probably benign Het
Sp7 T A 15: 102,358,792 H211L possibly damaging Het
Ssh3 A G 19: 4,269,025 V19A possibly damaging Het
Tcp11l2 A G 10: 84,613,658 I496V probably damaging Het
Tenm3 C T 8: 48,276,382 A1530T Het
Tmem232 A G 17: 65,436,372 L308P probably damaging Het
Tulp4 A G 17: 6,139,134 N77S probably damaging Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Usp48 A T 4: 137,613,769 D360V probably damaging Het
Vmn2r84 G A 10: 130,391,099 A290V probably benign Het
Zfp512b T C 2: 181,586,732 N738S probably benign Het
Other mutations in Gm10093
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Gm10093 APN 17 78492129 missense probably damaging 1.00
IGL01983:Gm10093 APN 17 78492853 missense probably benign
IGL02543:Gm10093 APN 17 78491874 missense probably damaging 0.97
buttress UTSW 17 78492914 missense possibly damaging 0.91
Chartre UTSW 17 78492540 missense probably damaging 0.99
R1174:Gm10093 UTSW 17 78492078 missense probably benign 0.01
R1605:Gm10093 UTSW 17 78492108 missense probably damaging 0.98
R2416:Gm10093 UTSW 17 78492516 missense probably damaging 1.00
R2919:Gm10093 UTSW 17 78492846 missense probably damaging 0.98
R2920:Gm10093 UTSW 17 78492846 missense probably damaging 0.98
R3846:Gm10093 UTSW 17 78492972 missense possibly damaging 0.91
R4544:Gm10093 UTSW 17 78492959 missense probably benign 0.02
R4546:Gm10093 UTSW 17 78492959 missense probably benign 0.02
R5223:Gm10093 UTSW 17 78492438 missense probably benign 0.02
R5297:Gm10093 UTSW 17 78492758 missense probably benign
R6164:Gm10093 UTSW 17 78492287 missense probably damaging 0.99
R6568:Gm10093 UTSW 17 78492588 missense probably damaging 1.00
R6726:Gm10093 UTSW 17 78492858 missense probably damaging 0.99
R6901:Gm10093 UTSW 17 78492660 missense probably benign 0.07
R6923:Gm10093 UTSW 17 78492914 missense possibly damaging 0.91
R7838:Gm10093 UTSW 17 78492018 missense probably damaging 1.00
R8002:Gm10093 UTSW 17 78492287 missense probably damaging 0.99
R8728:Gm10093 UTSW 17 78492903 missense probably benign 0.01
R8920:Gm10093 UTSW 17 78491742 missense probably benign 0.37
X0060:Gm10093 UTSW 17 78492128 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTGTGGCTCAGATTCCCTG -3'
(R):5'- CTCTCTTCTGGGATGGCATC -3'

Sequencing Primer
(F):5'- GGCTCAGATTCCCTGTCTGG -3'
(R):5'- TCAGGGATGGCCTGCATCTG -3'
Posted On 2021-04-30