Incidental Mutation 'R0736:BC027072'
ID67310
Institutional Source Beutler Lab
Gene Symbol BC027072
Ensembl Gene ENSMUSG00000044375
Gene NamecDNA sequence BC027072
Synonyms
MMRRC Submission 038917-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R0736 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location71743557-71752885 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71744664 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1231 (V1231A)
Ref Sequence ENSEMBL: ENSMUSP00000051871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057405]
Predicted Effect probably benign
Transcript: ENSMUST00000057405
AA Change: V1231A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000051871
Gene: ENSMUSG00000044375
AA Change: V1231A

DomainStartEndE-ValueType
Pfam:Retinal 1 1255 N/A PFAM
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly expressed in photoreceptors and may associate with the primary cilium of the outer segment. The encoded protein appears to undergo post-translational lipid modification. Nonsense and missense variants of this gene appear to cause a recessive form of retinitis pigmentosa. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele develop severe early-onset retinal degeneration associated with a disorganized outer segment, progressive thinning of the outer nuclear layer, microglia activation, decreased a- and b-wave amplitudes, and nearly undetectable ERG responses by 8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,441,745 S702C probably damaging Het
Amn1 G A 6: 149,183,472 H37Y possibly damaging Het
Cacna2d3 A T 14: 29,058,628 H644Q probably benign Het
Calb1 G A 4: 15,898,917 V138M probably benign Het
Cep55 C A 19: 38,073,317 T402N probably benign Het
Chrnb3 G A 8: 27,385,050 A26T probably benign Het
Col6a3 C T 1: 90,804,089 V1481I possibly damaging Het
Dmxl2 C T 9: 54,378,817 V2695I probably damaging Het
Heatr5a A C 12: 51,896,561 probably null Het
Kmt2c C T 5: 25,295,434 M461I probably benign Het
Mapk9 G A 11: 49,883,254 D413N possibly damaging Het
Morc4 G T X: 139,854,951 Q239K probably benign Het
Myt1l T A 12: 29,827,814 V488D unknown Het
Neb A T 2: 52,192,012 Y24N probably damaging Het
Neo1 G A 9: 58,917,081 P688L possibly damaging Het
Nlrp9b A T 7: 20,049,450 D409V probably damaging Het
Pde7a T C 3: 19,231,043 N327D probably damaging Het
Pdzd8 C A 19: 59,344,933 V219L probably damaging Het
Pgc T A 17: 47,728,780 M33K probably damaging Het
Pik3ap1 T A 19: 41,332,319 T154S possibly damaging Het
Polm G C 11: 5,835,495 S188C possibly damaging Het
Slfn1 A T 11: 83,121,081 T8S probably benign Het
St8sia6 C T 2: 13,668,885 V179M probably benign Het
Tns3 A T 11: 8,519,474 F274I possibly damaging Het
Tspan5 T C 3: 138,868,398 probably null Het
Utp14b A G 1: 78,665,272 K296E probably damaging Het
Zbtb14 A G 17: 69,387,802 E165G possibly damaging Het
Zbtb17 C A 4: 141,461,786 H6N probably damaging Het
Zw10 C T 9: 49,064,132 H286Y probably benign Het
Other mutations in BC027072
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02010:BC027072 APN 17 71749464 missense probably benign 0.38
IGL02033:BC027072 APN 17 71751081 missense probably damaging 1.00
IGL02711:BC027072 APN 17 71749382 missense probably benign 0.15
IGL03185:BC027072 APN 17 71749337 missense probably damaging 0.98
IGL03242:BC027072 APN 17 71750271 missense probably benign 0.01
R0367:BC027072 UTSW 17 71750476 missense probably damaging 1.00
R0413:BC027072 UTSW 17 71752217 missense probably benign 0.38
R0465:BC027072 UTSW 17 71750160 missense probably benign 0.42
R0535:BC027072 UTSW 17 71752439 missense probably benign 0.01
R0681:BC027072 UTSW 17 71749514 missense probably benign 0.00
R1406:BC027072 UTSW 17 71749161 missense probably benign 0.18
R1406:BC027072 UTSW 17 71749161 missense probably benign 0.18
R1530:BC027072 UTSW 17 71749478 missense probably benign 0.01
R1723:BC027072 UTSW 17 71750378 missense probably damaging 1.00
R1941:BC027072 UTSW 17 71752068 missense probably damaging 1.00
R2179:BC027072 UTSW 17 71752526 missense probably damaging 1.00
R2232:BC027072 UTSW 17 71749284 missense probably benign 0.00
R2519:BC027072 UTSW 17 71751647 missense probably damaging 1.00
R2997:BC027072 UTSW 17 71744711 critical splice acceptor site probably benign
R3899:BC027072 UTSW 17 71750160 missense probably benign 0.00
R4890:BC027072 UTSW 17 71752311 missense possibly damaging 0.50
R4898:BC027072 UTSW 17 71751071 missense probably damaging 1.00
R5347:BC027072 UTSW 17 71749935 missense probably benign 0.00
R5436:BC027072 UTSW 17 71750842 missense probably damaging 1.00
R5527:BC027072 UTSW 17 71752640 missense probably damaging 1.00
R5556:BC027072 UTSW 17 71752425 missense possibly damaging 0.81
R5625:BC027072 UTSW 17 71751326 missense probably damaging 1.00
R5707:BC027072 UTSW 17 71751572 missense possibly damaging 0.90
R5932:BC027072 UTSW 17 71751753 missense probably damaging 1.00
R6043:BC027072 UTSW 17 71750042 missense probably damaging 1.00
R6314:BC027072 UTSW 17 71752457 missense probably benign 0.04
R6513:BC027072 UTSW 17 71744706 missense probably damaging 1.00
R7575:BC027072 UTSW 17 71750855 missense probably damaging 1.00
R7638:BC027072 UTSW 17 71750885 missense probably damaging 1.00
R7848:BC027072 UTSW 17 71749193 missense probably benign 0.04
R8317:BC027072 UTSW 17 71749202 missense probably benign 0.10
X0035:BC027072 UTSW 17 71744711 critical splice acceptor site probably benign
Z1177:BC027072 UTSW 17 71750403 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAAGATCCTTCCAAGTCAACCGC -3'
(R):5'- TGCAGAACCGACAATCTGGCCTTC -3'

Sequencing Primer
(F):5'- GTGTGAACACGTCACTAGTACTTC -3'
(R):5'- GACAATCTGGCCTTCCAAGTG -3'
Posted On2013-09-03