Incidental Mutation 'R8822:Setd1a'
ID 673116
Institutional Source Beutler Lab
Gene Symbol Setd1a
Ensembl Gene ENSMUSG00000042308
Gene Name SET domain containing 1A
Synonyms KMT2F
MMRRC Submission 068655-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8822 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 127376561-127399294 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 127385332 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 680 (L680F)
Ref Sequence ENSEMBL: ENSMUSP00000047672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000126761] [ENSMUST00000144406] [ENSMUST00000154987]
AlphaFold E9PYH6
Predicted Effect possibly damaging
Transcript: ENSMUST00000047075
AA Change: L680F

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308
AA Change: L680F

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000047157
AA Change: L680F

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308
AA Change: L680F

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126761
SMART Domains Protein: ENSMUSP00000120666
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144406
SMART Domains Protein: ENSMUSP00000115248
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000154987
AA Change: L137F

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a histone methyltransferase (HMT) complex that produces mono-, di-, and trimethylated histone H3 at Lys4. Trimethylation of histone H3 at lysine 4 (H3K4me3) is a chromatin modification known to generally mark the transcription start sites of active genes. The protein contains SET domains, a RNA recognition motif domain and is a member of the class V-like SAM-binding methyltransferase superfamily. [provided by RefSeq, Dec 2016]
PHENOTYPE: Animals homozygous for this allele were dead by E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb1 T C 19: 56,711,849 (GRCm39) V349A probably damaging Het
Atp2a2 A G 5: 122,629,772 (GRCm39) V99A possibly damaging Het
Bank1 T A 3: 135,809,640 (GRCm39) D418V possibly damaging Het
Cacna1d A G 14: 29,900,692 (GRCm39) V331A probably benign Het
Cd28 A T 1: 60,808,820 (GRCm39) N178I possibly damaging Het
Cdcp3 A T 7: 130,843,706 (GRCm39) probably null Het
Ceacam12 T C 7: 17,803,378 (GRCm39) probably benign Het
Cfap54 G A 10: 92,875,003 (GRCm39) A494V probably benign Het
Chpt1 A G 10: 88,324,268 (GRCm39) V180A probably damaging Het
Cplane1 T C 15: 8,201,262 (GRCm39) I13T probably damaging Het
Cplx3 A G 9: 57,514,471 (GRCm39) V493A probably benign Het
Cyp4a31 G A 4: 115,422,225 (GRCm39) E70K probably benign Het
Fam151a A T 4: 106,602,842 (GRCm39) M254L probably benign Het
Fyco1 A T 9: 123,648,184 (GRCm39) I1250N probably damaging Het
Gm6685 T G 11: 28,289,768 (GRCm39) Q16P probably benign Het
Gpr26 A G 7: 131,568,997 (GRCm39) Y114C probably damaging Het
Helb A T 10: 119,941,389 (GRCm39) V433D probably benign Het
Hps3 A G 3: 20,057,391 (GRCm39) W930R probably benign Het
Igdcc4 C T 9: 65,031,298 (GRCm39) T412I possibly damaging Het
Klhl35 T C 7: 99,122,055 (GRCm39) V485A probably benign Het
Lmo7 A G 14: 102,121,610 (GRCm39) D225G probably damaging Het
Myo15a C T 11: 60,367,740 (GRCm39) R167C probably damaging Het
Obp2a A T 2: 25,590,188 (GRCm39) D29V probably damaging Het
Or10d3 C A 9: 39,461,812 (GRCm39) M118I probably benign Het
Or13a22 A G 7: 140,072,926 (GRCm39) Y125C possibly damaging Het
Or52b2 A G 7: 104,986,809 (GRCm39) V38A probably benign Het
Or5d47 A G 2: 87,804,785 (GRCm39) S75P possibly damaging Het
Or8g4 A G 9: 39,661,700 (GRCm39) Y6C probably benign Het
Pde6b A G 5: 108,551,328 (GRCm39) E204G probably benign Het
Pkd1 T C 17: 24,784,615 (GRCm39) V387A probably benign Het
Pkd1l1 A T 11: 8,806,312 (GRCm39) I2054K Het
Pkp1 T A 1: 135,807,661 (GRCm39) M536L probably benign Het
Platr25 T C 13: 62,848,658 (GRCm39) E68G probably benign Het
Plxna4 T C 6: 32,127,431 (GRCm39) D1892G possibly damaging Het
Pramel30 A G 4: 144,057,092 (GRCm39) K92E probably benign Het
Prr12 A G 7: 44,699,763 (GRCm39) L76P unknown Het
Ptprz1 T A 6: 23,002,588 (GRCm39) N1559K probably damaging Het
Rbl2 A T 8: 91,833,346 (GRCm39) N750I possibly damaging Het
Rhpn2 A T 7: 35,090,228 (GRCm39) M617L probably benign Het
Rprd2 A G 3: 95,691,613 (GRCm39) S221P probably damaging Het
S100a4 T C 3: 90,512,358 (GRCm39) S14P probably benign Het
Samd11 A T 4: 156,336,764 (GRCm39) L25Q probably damaging Het
Sash1 G A 10: 8,761,615 (GRCm39) probably benign Het
Scn9a A G 2: 66,370,979 (GRCm39) S534P probably damaging Het
Sec31b C A 19: 44,507,702 (GRCm39) V781F probably benign Het
Slc10a2 T G 8: 5,139,149 (GRCm39) Q265P probably damaging Het
Slc27a1 T A 8: 72,033,308 (GRCm39) D283E probably damaging Het
Slc38a4 G A 15: 96,906,952 (GRCm39) T262M probably benign Het
Slc52a3 T G 2: 151,846,513 (GRCm39) V158G probably benign Het
Snx16 T C 3: 10,484,125 (GRCm39) V64A probably benign Het
Stox1 A T 10: 62,499,900 (GRCm39) W887R probably damaging Het
Tcap G A 11: 98,275,264 (GRCm39) V133M probably benign Het
Ticam1 A G 17: 56,578,444 (GRCm39) L217P probably damaging Het
Tnfrsf12a T C 17: 23,895,188 (GRCm39) S87G probably benign Het
Tyr G A 7: 87,142,330 (GRCm39) R77C probably damaging Het
Uba6 A G 5: 86,294,932 (GRCm39) probably benign Het
Usp24 G A 4: 106,269,410 (GRCm39) V2107M probably benign Het
Wdr64 T C 1: 175,544,920 (GRCm39) S118P probably damaging Het
Zbtb21 G A 16: 97,752,516 (GRCm39) T589I probably damaging Het
Zfp263 G T 16: 3,562,004 (GRCm39) probably benign Het
Zfp318 A G 17: 46,723,831 (GRCm39) T1945A probably benign Het
Zfp644 G T 5: 106,783,087 (GRCm39) R1065S possibly damaging Het
Zfp668 A T 7: 127,466,315 (GRCm39) S290T probably damaging Het
Zfp808 T A 13: 62,320,869 (GRCm39) D699E probably damaging Het
Other mutations in Setd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Setd1a APN 7 127,396,870 (GRCm39) unclassified probably benign
IGL02657:Setd1a APN 7 127,394,997 (GRCm39) unclassified probably benign
IGL02792:Setd1a APN 7 127,390,522 (GRCm39) missense unknown
IGL02876:Setd1a APN 7 127,377,673 (GRCm39) splice site probably benign
IGL02967:Setd1a APN 7 127,384,349 (GRCm39) unclassified probably benign
IGL03090:Setd1a APN 7 127,385,672 (GRCm39) missense possibly damaging 0.83
IGL03238:Setd1a APN 7 127,384,718 (GRCm39) missense possibly damaging 0.86
FR4449:Setd1a UTSW 7 127,384,498 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,485 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
FR4589:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
FR4737:Setd1a UTSW 7 127,384,484 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,488 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
R0367:Setd1a UTSW 7 127,387,358 (GRCm39) splice site probably benign
R0411:Setd1a UTSW 7 127,395,223 (GRCm39) unclassified probably benign
R0416:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
R0470:Setd1a UTSW 7 127,384,229 (GRCm39) unclassified probably benign
R0645:Setd1a UTSW 7 127,386,382 (GRCm39) missense probably damaging 0.96
R0667:Setd1a UTSW 7 127,385,765 (GRCm39) missense probably damaging 0.99
R1251:Setd1a UTSW 7 127,396,596 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1660:Setd1a UTSW 7 127,395,841 (GRCm39) unclassified probably benign
R1730:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R1760:Setd1a UTSW 7 127,385,062 (GRCm39) missense possibly damaging 0.68
R1783:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R2149:Setd1a UTSW 7 127,385,690 (GRCm39) missense possibly damaging 0.75
R2159:Setd1a UTSW 7 127,384,661 (GRCm39) missense possibly damaging 0.91
R2303:Setd1a UTSW 7 127,398,327 (GRCm39) unclassified probably benign
R2679:Setd1a UTSW 7 127,394,896 (GRCm39) unclassified probably benign
R3428:Setd1a UTSW 7 127,384,493 (GRCm39) unclassified probably benign
R4108:Setd1a UTSW 7 127,398,374 (GRCm39) unclassified probably benign
R4227:Setd1a UTSW 7 127,395,819 (GRCm39) unclassified probably benign
R4438:Setd1a UTSW 7 127,384,903 (GRCm39) missense possibly damaging 0.83
R4730:Setd1a UTSW 7 127,396,502 (GRCm39) unclassified probably benign
R4869:Setd1a UTSW 7 127,396,776 (GRCm39) unclassified probably benign
R4892:Setd1a UTSW 7 127,377,696 (GRCm39) missense probably damaging 0.99
R5152:Setd1a UTSW 7 127,383,197 (GRCm39) missense probably benign
R5502:Setd1a UTSW 7 127,396,420 (GRCm39) critical splice donor site probably null
R5527:Setd1a UTSW 7 127,384,801 (GRCm39) missense probably damaging 0.99
R6189:Setd1a UTSW 7 127,377,455 (GRCm39) splice site probably null
R6250:Setd1a UTSW 7 127,390,471 (GRCm39) missense unknown
R7131:Setd1a UTSW 7 127,395,590 (GRCm39) small deletion probably benign
R7988:Setd1a UTSW 7 127,385,366 (GRCm39) missense probably benign 0.02
R8029:Setd1a UTSW 7 127,385,386 (GRCm39) missense probably benign 0.08
R8079:Setd1a UTSW 7 127,384,225 (GRCm39) missense unknown
R8171:Setd1a UTSW 7 127,390,399 (GRCm39) missense unknown
R8175:Setd1a UTSW 7 127,395,415 (GRCm39) missense unknown
R8286:Setd1a UTSW 7 127,385,356 (GRCm39) missense possibly damaging 0.96
R8327:Setd1a UTSW 7 127,390,669 (GRCm39) missense unknown
R8460:Setd1a UTSW 7 127,383,292 (GRCm39) missense unknown
R8547:Setd1a UTSW 7 127,395,676 (GRCm39) unclassified probably benign
R8699:Setd1a UTSW 7 127,385,774 (GRCm39) missense possibly damaging 0.53
R8968:Setd1a UTSW 7 127,385,279 (GRCm39) missense possibly damaging 0.93
R9063:Setd1a UTSW 7 127,385,558 (GRCm39) missense possibly damaging 0.91
R9178:Setd1a UTSW 7 127,385,590 (GRCm39) missense possibly damaging 0.93
R9672:Setd1a UTSW 7 127,385,237 (GRCm39) missense possibly damaging 0.96
R9700:Setd1a UTSW 7 127,385,752 (GRCm39) missense possibly damaging 0.53
RF001:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF008:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF011:Setd1a UTSW 7 127,384,515 (GRCm39) unclassified probably benign
RF014:Setd1a UTSW 7 127,384,518 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,473 (GRCm39) unclassified probably benign
RF031:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF036:Setd1a UTSW 7 127,384,472 (GRCm39) unclassified probably benign
RF041:Setd1a UTSW 7 127,384,504 (GRCm39) unclassified probably benign
RF052:Setd1a UTSW 7 127,384,529 (GRCm39) unclassified probably benign
RF055:Setd1a UTSW 7 127,384,471 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,500 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,475 (GRCm39) unclassified probably benign
RF058:Setd1a UTSW 7 127,384,490 (GRCm39) unclassified probably benign
Z1176:Setd1a UTSW 7 127,398,266 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CTCTGATGATGACAGGGGTG -3'
(R):5'- ATAGGCTGCCTCTTGTGGAG -3'

Sequencing Primer
(F):5'- TGATGACAGGGGTGGCTCAC -3'
(R):5'- CTCTTGTGGAGGTGGAAAAGG -3'
Posted On 2021-04-30