Incidental Mutation 'R0736:Pdzd8'
ID67313
Institutional Source Beutler Lab
Gene Symbol Pdzd8
Ensembl Gene ENSMUSG00000074746
Gene NamePDZ domain containing 8
SynonymsA630041P07Rik, Pdzk8
MMRRC Submission 038917-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0736 (G1)
Quality Score181
Status Not validated
Chromosome19
Chromosomal Location59296084-59345780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 59344933 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 219 (V219L)
Ref Sequence ENSEMBL: ENSMUSP00000096880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099274]
Predicted Effect probably damaging
Transcript: ENSMUST00000099274
AA Change: V219L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096880
Gene: ENSMUSG00000074746
AA Change: V219L

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
PDZ 374 448 2.02e-10 SMART
low complexity region 582 596 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
C1 834 884 8.31e-8 SMART
coiled coil region 1021 1057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,441,745 S702C probably damaging Het
Amn1 G A 6: 149,183,472 H37Y possibly damaging Het
BC027072 A G 17: 71,744,664 V1231A probably benign Het
Cacna2d3 A T 14: 29,058,628 H644Q probably benign Het
Calb1 G A 4: 15,898,917 V138M probably benign Het
Cep55 C A 19: 38,073,317 T402N probably benign Het
Chrnb3 G A 8: 27,385,050 A26T probably benign Het
Col6a3 C T 1: 90,804,089 V1481I possibly damaging Het
Dmxl2 C T 9: 54,378,817 V2695I probably damaging Het
Heatr5a A C 12: 51,896,561 probably null Het
Kmt2c C T 5: 25,295,434 M461I probably benign Het
Mapk9 G A 11: 49,883,254 D413N possibly damaging Het
Morc4 G T X: 139,854,951 Q239K probably benign Het
Myt1l T A 12: 29,827,814 V488D unknown Het
Neb A T 2: 52,192,012 Y24N probably damaging Het
Neo1 G A 9: 58,917,081 P688L possibly damaging Het
Nlrp9b A T 7: 20,049,450 D409V probably damaging Het
Pde7a T C 3: 19,231,043 N327D probably damaging Het
Pgc T A 17: 47,728,780 M33K probably damaging Het
Pik3ap1 T A 19: 41,332,319 T154S possibly damaging Het
Polm G C 11: 5,835,495 S188C possibly damaging Het
Slfn1 A T 11: 83,121,081 T8S probably benign Het
St8sia6 C T 2: 13,668,885 V179M probably benign Het
Tns3 A T 11: 8,519,474 F274I possibly damaging Het
Tspan5 T C 3: 138,868,398 probably null Het
Utp14b A G 1: 78,665,272 K296E probably damaging Het
Zbtb14 A G 17: 69,387,802 E165G possibly damaging Het
Zbtb17 C A 4: 141,461,786 H6N probably damaging Het
Zw10 C T 9: 49,064,132 H286Y probably benign Het
Other mutations in Pdzd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Pdzd8 APN 19 59299786 missense probably damaging 1.00
IGL01321:Pdzd8 APN 19 59301529 missense probably benign
IGL01865:Pdzd8 APN 19 59299645 missense possibly damaging 0.92
IGL02044:Pdzd8 APN 19 59315292 missense possibly damaging 0.85
IGL02119:Pdzd8 APN 19 59300490 missense possibly damaging 0.95
IGL02186:Pdzd8 APN 19 59300628 missense probably damaging 1.00
IGL02389:Pdzd8 APN 19 59301393 missense probably benign 0.00
IGL02479:Pdzd8 APN 19 59299783 nonsense probably null
IGL02713:Pdzd8 APN 19 59345458 missense probably damaging 0.98
IGL02958:Pdzd8 APN 19 59300372 nonsense probably null
IGL02966:Pdzd8 APN 19 59300859 missense probably damaging 1.00
IGL03166:Pdzd8 APN 19 59300508 missense probably damaging 1.00
citadel UTSW 19 59299525 makesense probably null
Eleventh_hour UTSW 19 59305230 missense probably damaging 1.00
keep UTSW 19 59301351 nonsense probably null
Stronghold UTSW 19 59345352 nonsense probably null
R0018:Pdzd8 UTSW 19 59300673 missense probably damaging 1.00
R0038:Pdzd8 UTSW 19 59299596 missense possibly damaging 0.54
R0196:Pdzd8 UTSW 19 59301131 missense probably benign 0.00
R0233:Pdzd8 UTSW 19 59300379 missense probably damaging 0.99
R0233:Pdzd8 UTSW 19 59300379 missense probably damaging 0.99
R0418:Pdzd8 UTSW 19 59300929 missense probably damaging 1.00
R1456:Pdzd8 UTSW 19 59300472 missense probably benign 0.01
R1709:Pdzd8 UTSW 19 59301339 missense probably benign
R1965:Pdzd8 UTSW 19 59300122 missense probably benign 0.37
R2155:Pdzd8 UTSW 19 59300421 missense probably damaging 1.00
R3077:Pdzd8 UTSW 19 59305156 critical splice donor site probably null
R3411:Pdzd8 UTSW 19 59345413 missense probably damaging 1.00
R4345:Pdzd8 UTSW 19 59300128 missense probably benign 0.00
R4354:Pdzd8 UTSW 19 59345481 missense probably benign
R4504:Pdzd8 UTSW 19 59345448 missense probably damaging 1.00
R4642:Pdzd8 UTSW 19 59305230 missense probably damaging 1.00
R4705:Pdzd8 UTSW 19 59345311 missense possibly damaging 0.80
R4773:Pdzd8 UTSW 19 59300860 missense probably damaging 1.00
R4876:Pdzd8 UTSW 19 59300804 nonsense probably null
R5176:Pdzd8 UTSW 19 59344957 missense probably damaging 1.00
R5267:Pdzd8 UTSW 19 59301026 missense probably damaging 1.00
R5707:Pdzd8 UTSW 19 59299625 missense probably benign 0.00
R5766:Pdzd8 UTSW 19 59300540 missense possibly damaging 0.65
R5903:Pdzd8 UTSW 19 59345286 missense possibly damaging 0.58
R6036:Pdzd8 UTSW 19 59305209 missense probably damaging 1.00
R6036:Pdzd8 UTSW 19 59305209 missense probably damaging 1.00
R6238:Pdzd8 UTSW 19 59300562 missense probably benign 0.05
R6360:Pdzd8 UTSW 19 59300983 missense probably benign 0.10
R6509:Pdzd8 UTSW 19 59344866 missense probably benign 0.01
R6674:Pdzd8 UTSW 19 59301369 missense probably damaging 1.00
R6808:Pdzd8 UTSW 19 59299525 makesense probably null
R6902:Pdzd8 UTSW 19 59301397 missense possibly damaging 0.91
R7017:Pdzd8 UTSW 19 59345352 nonsense probably null
R7088:Pdzd8 UTSW 19 59344957 missense probably damaging 1.00
R7116:Pdzd8 UTSW 19 59299693 missense probably damaging 1.00
R7158:Pdzd8 UTSW 19 59300157 missense probably damaging 1.00
R7237:Pdzd8 UTSW 19 59345139 missense probably damaging 1.00
R7251:Pdzd8 UTSW 19 59300645 missense possibly damaging 0.96
R7314:Pdzd8 UTSW 19 59301351 nonsense probably null
R7699:Pdzd8 UTSW 19 59344941 missense probably damaging 1.00
R7751:Pdzd8 UTSW 19 59344776 missense probably damaging 0.98
R7759:Pdzd8 UTSW 19 59299926 missense probably damaging 1.00
R7784:Pdzd8 UTSW 19 59327863 missense probably damaging 1.00
R7917:Pdzd8 UTSW 19 59345086 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTCACCTGATCTTGTAACTGGGCAG -3'
(R):5'- ACACGGTGCCCTTCATCAAGAC -3'

Sequencing Primer
(F):5'- GCTTGCGCTTGATGATCTTC -3'
(R):5'- TTCATCAAGACCATCCGGC -3'
Posted On2013-09-03