Incidental Mutation 'R8725:Bpifb2'
ID 673158
Institutional Source Beutler Lab
Gene Symbol Bpifb2
Ensembl Gene ENSMUSG00000027481
Gene Name BPI fold containing family B, member 2
Synonyms 2310069A01Rik, Bpil1, 2310034L21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock # R8725 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 153875045-153895270 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 153889436 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 244 (H244R)
Ref Sequence ENSEMBL: ENSMUSP00000028983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028983]
AlphaFold Q8C1E1
Predicted Effect possibly damaging
Transcript: ENSMUST00000028983
AA Change: H244R

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028983
Gene: ENSMUSG00000027481
AA Change: H244R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:LBP_BPI_CETP 36 194 2.4e-27 PFAM
BPI2 253 456 2.67e-26 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lipid transfer/lipopolysaccharide binding protein (LT/LBP) gene family. It is highly expressed in hypertrophic tonsils. This gene and three other members of the LT/LBP gene family form a cluster on the long arm of chromosome 20. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T A 14: 103,049,639 W69R probably damaging Het
Adamtsl4 C T 3: 95,677,116 R990Q possibly damaging Het
Ahdc1 T A 4: 133,065,432 V1328E possibly damaging Het
C87414 A T 5: 93,636,457 Y383N probably damaging Het
Camk1 C A 6: 113,338,148 V199L probably damaging Het
Ccdc18 A T 5: 108,180,417 K661I possibly damaging Het
Cdh16 C T 8: 104,618,242 V444I probably benign Het
Cep295 A T 9: 15,332,419 Y1580* probably null Het
Cntnap5c A T 17: 58,055,668 N339Y probably damaging Het
Col6a3 C G 1: 90,767,606 probably benign Het
Deup1 T A 9: 15,592,425 D280V probably damaging Het
Dlat G T 9: 50,649,667 A360E probably damaging Het
Evpl T A 11: 116,222,193 D1557V probably benign Het
Ext1 A G 15: 53,344,669 V232A possibly damaging Het
Gdpd5 T C 7: 99,456,519 I514T possibly damaging Het
Gm14443 A T 2: 175,168,900 C584* probably null Het
Gm2696 T A 10: 77,836,200 C78S unknown Het
Gm4131 T C 14: 62,463,851 D276G possibly damaging Het
Gm5114 C T 7: 39,411,233 G64D probably benign Het
Gm5861 A T 5: 11,186,441 Q147L probably benign Het
Gsx2 G T 5: 75,076,094 A112S probably benign Het
Hebp1 G T 6: 135,137,921 R181S probably damaging Het
Hectd4 G A 5: 121,350,494 G3616D probably damaging Het
Hemgn T G 4: 46,394,638 T491P probably benign Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Itsn1 T C 16: 91,839,833 S723P unknown Het
Kat6a G A 8: 22,908,277 G287D probably damaging Het
Ktn1 T G 14: 47,670,300 probably benign Het
Lrrc56 C A 7: 141,198,333 D79E possibly damaging Het
Lrrn1 C T 6: 107,567,342 Q34* probably null Het
Mlxipl A G 5: 135,128,629 M340V probably benign Het
Mroh6 T C 15: 75,884,714 T604A possibly damaging Het
Olfr1228 A T 2: 89,249,314 S115T probably benign Het
Olfr351 T A 2: 36,859,598 Y250F probably damaging Het
Olfr541 G T 7: 140,704,694 V148L probably benign Het
Palb2 A C 7: 122,111,661 V1022G unknown Het
Pank1 T G 19: 34,878,589 H163P possibly damaging Het
Pcdha12 A G 18: 37,021,683 Q485R probably benign Het
Pcdhb15 T A 18: 37,475,681 S655R probably damaging Het
Pcdhgb1 T A 18: 37,681,414 C319* probably null Het
Pipox A T 11: 77,883,978 L93* probably null Het
Pkd1l1 A C 11: 8,961,482 V265G Het
Pld3 G A 7: 27,539,654 Q149* probably null Het
Prpf3 T A 3: 95,840,709 T415S possibly damaging Het
Rasgef1b G A 5: 99,300,036 T105I unknown Het
Rere G T 4: 150,617,335 E24* probably null Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Ric3 A T 7: 109,038,717 D277E probably benign Het
Rnf44 A T 13: 54,684,013 M82K probably damaging Het
Rsph14 T C 10: 74,959,684 N223S probably benign Het
Rusc2 A G 4: 43,415,396 E234G probably damaging Het
Scfd2 T C 5: 74,482,239 N349S probably benign Het
Sema3d G A 5: 12,505,855 C183Y probably damaging Het
Setd2 T C 9: 110,573,844 I74T Het
Slc39a12 T C 2: 14,449,859 S563P probably damaging Het
Slc9a8 A T 2: 167,473,534 D526V probably damaging Het
Smpdl3b G T 4: 132,733,749 T339N probably damaging Het
Spi1 G A 2: 91,115,171 G199D probably damaging Het
Stx2 T C 5: 128,993,500 T118A probably damaging Het
Synj2 C A 17: 6,037,740 S1355R possibly damaging Het
Taf15 A G 11: 83,499,138 T245A probably benign Het
Tnrc6b C T 15: 80,876,452 A120V probably damaging Het
Usp19 G T 9: 108,493,735 G198W probably damaging Het
Wdtc1 G T 4: 133,313,803 H46N probably damaging Het
Zbtb1 C A 12: 76,385,872 R211S probably damaging Het
Zc3h8 A G 2: 128,933,287 V151A probably benign Het
Zfp219 T C 14: 52,007,442 T499A possibly damaging Het
Zfp689 A G 7: 127,448,768 F31L probably damaging Het
Zfp879 C T 11: 50,838,494 D26N probably damaging Het
Other mutations in Bpifb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02001:Bpifb2 APN 2 153891275 splice site probably benign
IGL02164:Bpifb2 APN 2 153883562 missense probably damaging 0.99
IGL03063:Bpifb2 APN 2 153889124 missense probably damaging 1.00
R0044:Bpifb2 UTSW 2 153882679 splice site probably benign
R0044:Bpifb2 UTSW 2 153882679 splice site probably benign
R0084:Bpifb2 UTSW 2 153891091 missense probably benign 0.03
R0791:Bpifb2 UTSW 2 153878519 missense probably benign 0.05
R1503:Bpifb2 UTSW 2 153889510 missense possibly damaging 0.83
R2278:Bpifb2 UTSW 2 153878479 nonsense probably null
R3810:Bpifb2 UTSW 2 153891951 missense probably benign 0.04
R3812:Bpifb2 UTSW 2 153891951 missense probably benign 0.04
R4030:Bpifb2 UTSW 2 153891317 missense probably benign 0.30
R4573:Bpifb2 UTSW 2 153889492 missense probably damaging 0.99
R4713:Bpifb2 UTSW 2 153881193 missense probably damaging 0.98
R5143:Bpifb2 UTSW 2 153878504 missense probably damaging 1.00
R5523:Bpifb2 UTSW 2 153875985 unclassified probably benign
R5899:Bpifb2 UTSW 2 153891130 missense probably damaging 1.00
R6011:Bpifb2 UTSW 2 153889576 splice site probably null
R6172:Bpifb2 UTSW 2 153890412 missense probably benign 0.15
R6378:Bpifb2 UTSW 2 153891152 missense possibly damaging 0.93
R6878:Bpifb2 UTSW 2 153875912 unclassified probably benign
R7381:Bpifb2 UTSW 2 153892348 missense probably benign 0.01
R7390:Bpifb2 UTSW 2 153889806 missense possibly damaging 0.89
R7424:Bpifb2 UTSW 2 153890540 missense possibly damaging 0.93
R7473:Bpifb2 UTSW 2 153881196 missense possibly damaging 0.80
R7493:Bpifb2 UTSW 2 153889477 missense possibly damaging 0.74
R8145:Bpifb2 UTSW 2 153891312 missense probably damaging 1.00
R8178:Bpifb2 UTSW 2 153891956 missense probably damaging 0.99
R8960:Bpifb2 UTSW 2 153889126 missense possibly damaging 0.90
R9201:Bpifb2 UTSW 2 153891983 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TCCTAAGACGGTAGAGGGTG -3'
(R):5'- TGCATCTACAGCATGACCC -3'

Sequencing Primer
(F):5'- CTAAGACGGTAGAGGGTGAAGGG -3'
(R):5'- TACAGGGCGCCCTTCTACAAG -3'
Posted On 2021-04-30