Incidental Mutation 'R8725:Slc9a8'
ID673159
Institutional Source Beutler Lab
Gene Symbol Slc9a8
Ensembl Gene ENSMUSG00000039463
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 8
Synonyms1200006P13Rik, 6430709P13Rik, NHE8
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8725 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location167421712-167477000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 167473534 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 526 (D526V)
Ref Sequence ENSEMBL: ENSMUSP00000044185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047815] [ENSMUST00000073873] [ENSMUST00000109218]
Predicted Effect probably damaging
Transcript: ENSMUST00000047815
AA Change: D526V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044185
Gene: ENSMUSG00000039463
AA Change: D526V

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 57 468 3.3e-69 PFAM
low complexity region 497 513 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000073873
AA Change: D499V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073536
Gene: ENSMUSG00000039463
AA Change: D499V

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 54 441 3.5e-62 PFAM
low complexity region 470 486 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109218
AA Change: D495V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104841
Gene: ENSMUSG00000039463
AA Change: D495V

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 54 437 3.7e-61 PFAM
low complexity region 466 482 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Na+/H+ exchanger (NHE) family of integral membrane transporter proteins. The encoded protein is expressed on the apical membrane of the intestinal epithelial cells and plays an important role in mucosal protection. Loss of the encoded protein in mice results in a decrease in the number of goblet and mucin-positive cells, disorganization of the mucin layer, and a decrease in mucosal pH in the colon. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male infertility, impaired mucin synthesis and bicarbonate secretion in the colon, abnormal blood coagulation and increased length of the small intestine, cecum and ileum crypts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T A 14: 103,049,639 W69R probably damaging Het
Adamtsl4 C T 3: 95,677,116 R990Q possibly damaging Het
Ahdc1 T A 4: 133,065,432 V1328E possibly damaging Het
Bpifb2 A G 2: 153,889,436 H244R possibly damaging Het
C87414 A T 5: 93,636,457 Y383N probably damaging Het
Camk1 C A 6: 113,338,148 V199L probably damaging Het
Ccdc18 A T 5: 108,180,417 K661I possibly damaging Het
Cdh16 C T 8: 104,618,242 V444I probably benign Het
Cep295 A T 9: 15,332,419 Y1580* probably null Het
Cntnap5c A T 17: 58,055,668 N339Y probably damaging Het
Col6a3 C G 1: 90,767,606 probably benign Het
Deup1 T A 9: 15,592,425 D280V probably damaging Het
Dlat G T 9: 50,649,667 A360E probably damaging Het
Evpl T A 11: 116,222,193 D1557V probably benign Het
Ext1 A G 15: 53,344,669 V232A possibly damaging Het
Gdpd5 T C 7: 99,456,519 I514T possibly damaging Het
Gm14443 A T 2: 175,168,900 C584* probably null Het
Gm2696 T A 10: 77,836,200 C78S unknown Het
Gm4131 T C 14: 62,463,851 D276G possibly damaging Het
Gm5114 C T 7: 39,411,233 G64D probably benign Het
Gm5861 A T 5: 11,186,441 Q147L probably benign Het
Gsx2 G T 5: 75,076,094 A112S probably benign Het
Hebp1 G T 6: 135,137,921 R181S probably damaging Het
Hectd4 G A 5: 121,350,494 G3616D probably damaging Het
Hemgn T G 4: 46,394,638 T491P probably benign Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Itsn1 T C 16: 91,839,833 S723P unknown Het
Kat6a G A 8: 22,908,277 G287D probably damaging Het
Ktn1 T G 14: 47,670,300 probably benign Het
Lrrc56 C A 7: 141,198,333 D79E possibly damaging Het
Lrrn1 C T 6: 107,567,342 Q34* probably null Het
Mlxipl A G 5: 135,128,629 M340V probably benign Het
Mroh6 T C 15: 75,884,714 T604A possibly damaging Het
Olfr1228 A T 2: 89,249,314 S115T probably benign Het
Olfr351 T A 2: 36,859,598 Y250F probably damaging Het
Olfr541 G T 7: 140,704,694 V148L probably benign Het
Palb2 A C 7: 122,111,661 V1022G unknown Het
Pank1 T G 19: 34,878,589 H163P possibly damaging Het
Pcdha12 A G 18: 37,021,683 Q485R probably benign Het
Pcdhb15 T A 18: 37,475,681 S655R probably damaging Het
Pcdhgb1 T A 18: 37,681,414 C319* probably null Het
Pipox A T 11: 77,883,978 L93* probably null Het
Pkd1l1 A C 11: 8,961,482 V265G Het
Pld3 G A 7: 27,539,654 Q149* probably null Het
Prpf3 T A 3: 95,840,709 T415S possibly damaging Het
Rasgef1b G A 5: 99,300,036 T105I unknown Het
Rere G T 4: 150,617,335 E24* probably null Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Ric3 A T 7: 109,038,717 D277E probably benign Het
Rnf44 A T 13: 54,684,013 M82K probably damaging Het
Rsph14 T C 10: 74,959,684 N223S probably benign Het
Rusc2 A G 4: 43,415,396 E234G probably damaging Het
Scfd2 T C 5: 74,482,239 N349S probably benign Het
Sema3d G A 5: 12,505,855 C183Y probably damaging Het
Setd2 T C 9: 110,573,844 I74T Het
Slc39a12 T C 2: 14,449,859 S563P probably damaging Het
Smpdl3b G T 4: 132,733,749 T339N probably damaging Het
Spi1 G A 2: 91,115,171 G199D probably damaging Het
Stx2 T C 5: 128,993,500 T118A probably damaging Het
Synj2 C A 17: 6,037,740 S1355R possibly damaging Het
Taf15 A G 11: 83,499,138 T245A probably benign Het
Tnrc6b C T 15: 80,876,452 A120V probably damaging Het
Usp19 G T 9: 108,493,735 G198W probably damaging Het
Wdtc1 G T 4: 133,313,803 H46N probably damaging Het
Zbtb1 C A 12: 76,385,872 R211S probably damaging Het
Zc3h8 A G 2: 128,933,287 V151A probably benign Het
Zfp219 T C 14: 52,007,442 T499A possibly damaging Het
Zfp689 A G 7: 127,448,768 F31L probably damaging Het
Zfp879 C T 11: 50,838,494 D26N probably damaging Het
Other mutations in Slc9a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Slc9a8 APN 2 167424166 missense possibly damaging 0.46
IGL02626:Slc9a8 APN 2 167467677 splice site probably benign
costello UTSW 2 167451296 missense probably damaging 1.00
R0270:Slc9a8 UTSW 2 167451296 missense probably damaging 1.00
R0417:Slc9a8 UTSW 2 167457344 missense probably benign 0.00
R0504:Slc9a8 UTSW 2 167424205 missense probably benign
R0906:Slc9a8 UTSW 2 167434867 intron probably benign
R1216:Slc9a8 UTSW 2 167424121 missense probably benign 0.00
R1225:Slc9a8 UTSW 2 167471523 missense probably benign 0.20
R1604:Slc9a8 UTSW 2 167471432 missense probably benign 0.09
R1728:Slc9a8 UTSW 2 167424145 missense probably benign 0.00
R1729:Slc9a8 UTSW 2 167424145 missense probably benign 0.00
R1773:Slc9a8 UTSW 2 167471465 missense possibly damaging 0.57
R1775:Slc9a8 UTSW 2 167457358 missense probably benign 0.12
R1918:Slc9a8 UTSW 2 167424214 missense possibly damaging 0.95
R2312:Slc9a8 UTSW 2 167451276 missense probably benign 0.01
R3031:Slc9a8 UTSW 2 167451281 missense probably damaging 1.00
R3752:Slc9a8 UTSW 2 167457352 missense probably benign
R3757:Slc9a8 UTSW 2 167424130 missense probably benign 0.01
R4499:Slc9a8 UTSW 2 167424193 missense probably benign 0.01
R4746:Slc9a8 UTSW 2 167441170 nonsense probably null
R4904:Slc9a8 UTSW 2 167471396 missense possibly damaging 0.51
R4969:Slc9a8 UTSW 2 167446529 missense probably benign 0.06
R5395:Slc9a8 UTSW 2 167467722 missense probably damaging 0.99
R5811:Slc9a8 UTSW 2 167471387 nonsense probably null
R5908:Slc9a8 UTSW 2 167451170 intron probably benign
R6311:Slc9a8 UTSW 2 167451220 missense probably damaging 1.00
R6443:Slc9a8 UTSW 2 167434821 missense probably benign 0.00
R6494:Slc9a8 UTSW 2 167424291 missense probably damaging 1.00
R7161:Slc9a8 UTSW 2 167465383 missense possibly damaging 0.90
R7322:Slc9a8 UTSW 2 167451302 missense probably damaging 1.00
R7354:Slc9a8 UTSW 2 167474131 missense possibly damaging 0.93
R7896:Slc9a8 UTSW 2 167465358 missense probably benign 0.07
R8095:Slc9a8 UTSW 2 167468971 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATCACCTGTACTAAGGCAGG -3'
(R):5'- GAGGTGTCACGCTATCACAC -3'

Sequencing Primer
(F):5'- TCACCTGTACTAAGGCAGGATGTG -3'
(R):5'- TATCACACATAGCTTGGGAATCC -3'
Posted On2021-04-30