Incidental Mutation 'R8725:Rusc2'
ID673163
Institutional Source Beutler Lab
Gene Symbol Rusc2
Ensembl Gene ENSMUSG00000035969
Gene NameRUN and SH3 domain containing 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R8725 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location43381979-43427088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43415396 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 234 (E234G)
Ref Sequence ENSEMBL: ENSMUSP00000038379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035645] [ENSMUST00000098106] [ENSMUST00000125399] [ENSMUST00000131668] [ENSMUST00000135216] [ENSMUST00000136360] [ENSMUST00000139198] [ENSMUST00000144911] [ENSMUST00000149221] [ENSMUST00000152322] [ENSMUST00000173682]
Predicted Effect probably damaging
Transcript: ENSMUST00000035645
AA Change: E234G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038379
Gene: ENSMUSG00000035969
AA Change: E234G

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098106
AA Change: E234G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095710
Gene: ENSMUSG00000035969
AA Change: E234G

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125399
Predicted Effect probably benign
Transcript: ENSMUST00000131668
AA Change: E234G

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000118528
Gene: ENSMUSG00000035969
AA Change: E234G

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135216
Predicted Effect probably benign
Transcript: ENSMUST00000136360
SMART Domains Protein: ENSMUSP00000123431
Gene: ENSMUSG00000035969

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139198
SMART Domains Protein: ENSMUSP00000121528
Gene: ENSMUSG00000035969

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144911
Predicted Effect probably benign
Transcript: ENSMUST00000149221
Predicted Effect probably benign
Transcript: ENSMUST00000152322
Predicted Effect probably damaging
Transcript: ENSMUST00000173682
AA Change: E234G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133715
Gene: ENSMUSG00000035969
AA Change: E234G

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 685 703 N/A INTRINSIC
low complexity region 733 740 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RUN and SH3 domain containing protein that interacts with Rab1b and Rab1-binding protein GM130. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T A 14: 103,049,639 W69R probably damaging Het
Adamtsl4 C T 3: 95,677,116 R990Q possibly damaging Het
Ahdc1 T A 4: 133,065,432 V1328E possibly damaging Het
Bpifb2 A G 2: 153,889,436 H244R possibly damaging Het
C87414 A T 5: 93,636,457 Y383N probably damaging Het
Camk1 C A 6: 113,338,148 V199L probably damaging Het
Ccdc18 A T 5: 108,180,417 K661I possibly damaging Het
Cdh16 C T 8: 104,618,242 V444I probably benign Het
Cep295 A T 9: 15,332,419 Y1580* probably null Het
Cntnap5c A T 17: 58,055,668 N339Y probably damaging Het
Col6a3 C G 1: 90,767,606 probably benign Het
Deup1 T A 9: 15,592,425 D280V probably damaging Het
Dlat G T 9: 50,649,667 A360E probably damaging Het
Evpl T A 11: 116,222,193 D1557V probably benign Het
Ext1 A G 15: 53,344,669 V232A possibly damaging Het
Gdpd5 T C 7: 99,456,519 I514T possibly damaging Het
Gm14443 A T 2: 175,168,900 C584* probably null Het
Gm2696 T A 10: 77,836,200 C78S unknown Het
Gm4131 T C 14: 62,463,851 D276G possibly damaging Het
Gm5114 C T 7: 39,411,233 G64D probably benign Het
Gm5861 A T 5: 11,186,441 Q147L probably benign Het
Gsx2 G T 5: 75,076,094 A112S probably benign Het
Hebp1 G T 6: 135,137,921 R181S probably damaging Het
Hectd4 G A 5: 121,350,494 G3616D probably damaging Het
Hemgn T G 4: 46,394,638 T491P probably benign Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Itsn1 T C 16: 91,839,833 S723P unknown Het
Kat6a G A 8: 22,908,277 G287D probably damaging Het
Ktn1 T G 14: 47,670,300 probably benign Het
Lrrc56 C A 7: 141,198,333 D79E possibly damaging Het
Lrrn1 C T 6: 107,567,342 Q34* probably null Het
Mlxipl A G 5: 135,128,629 M340V probably benign Het
Mroh6 T C 15: 75,884,714 T604A possibly damaging Het
Olfr1228 A T 2: 89,249,314 S115T probably benign Het
Olfr351 T A 2: 36,859,598 Y250F probably damaging Het
Olfr541 G T 7: 140,704,694 V148L probably benign Het
Palb2 A C 7: 122,111,661 V1022G unknown Het
Pank1 T G 19: 34,878,589 H163P possibly damaging Het
Pcdha12 A G 18: 37,021,683 Q485R probably benign Het
Pcdhb15 T A 18: 37,475,681 S655R probably damaging Het
Pcdhgb1 T A 18: 37,681,414 C319* probably null Het
Pipox A T 11: 77,883,978 L93* probably null Het
Pkd1l1 A C 11: 8,961,482 V265G Het
Pld3 G A 7: 27,539,654 Q149* probably null Het
Prpf3 T A 3: 95,840,709 T415S possibly damaging Het
Rasgef1b G A 5: 99,300,036 T105I unknown Het
Rere G T 4: 150,617,335 E24* probably null Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Ric3 A T 7: 109,038,717 D277E probably benign Het
Rnf44 A T 13: 54,684,013 M82K probably damaging Het
Rsph14 T C 10: 74,959,684 N223S probably benign Het
Scfd2 T C 5: 74,482,239 N349S probably benign Het
Sema3d G A 5: 12,505,855 C183Y probably damaging Het
Setd2 T C 9: 110,573,844 I74T Het
Slc39a12 T C 2: 14,449,859 S563P probably damaging Het
Slc9a8 A T 2: 167,473,534 D526V probably damaging Het
Smpdl3b G T 4: 132,733,749 T339N probably damaging Het
Spi1 G A 2: 91,115,171 G199D probably damaging Het
Stx2 T C 5: 128,993,500 T118A probably damaging Het
Synj2 C A 17: 6,037,740 S1355R possibly damaging Het
Taf15 A G 11: 83,499,138 T245A probably benign Het
Tnrc6b C T 15: 80,876,452 A120V probably damaging Het
Usp19 G T 9: 108,493,735 G198W probably damaging Het
Wdtc1 G T 4: 133,313,803 H46N probably damaging Het
Zbtb1 C A 12: 76,385,872 R211S probably damaging Het
Zc3h8 A G 2: 128,933,287 V151A probably benign Het
Zfp219 T C 14: 52,007,442 T499A possibly damaging Het
Zfp689 A G 7: 127,448,768 F31L probably damaging Het
Zfp879 C T 11: 50,838,494 D26N probably damaging Het
Other mutations in Rusc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Rusc2 APN 4 43426116 missense probably damaging 0.97
IGL01474:Rusc2 APN 4 43416434 missense probably damaging 0.98
IGL01541:Rusc2 APN 4 43415840 missense probably benign 0.08
IGL01628:Rusc2 APN 4 43425729 missense probably damaging 1.00
IGL01969:Rusc2 APN 4 43415738 missense probably benign 0.02
IGL02030:Rusc2 APN 4 43416095 missense possibly damaging 0.86
IGL02079:Rusc2 APN 4 43425668 missense probably benign
IGL02115:Rusc2 APN 4 43426136 splice site probably benign
IGL02122:Rusc2 APN 4 43421685 missense possibly damaging 0.67
IGL02350:Rusc2 APN 4 43425351 missense possibly damaging 0.86
IGL02357:Rusc2 APN 4 43425351 missense possibly damaging 0.86
IGL02437:Rusc2 APN 4 43415545 missense probably damaging 1.00
IGL02930:Rusc2 APN 4 43416376 missense probably damaging 0.99
IGL03154:Rusc2 APN 4 43425806 missense probably benign 0.00
P0026:Rusc2 UTSW 4 43415840 missense possibly damaging 0.93
R0036:Rusc2 UTSW 4 43424009 missense probably damaging 1.00
R0068:Rusc2 UTSW 4 43424100 splice site probably benign
R0068:Rusc2 UTSW 4 43424100 splice site probably benign
R0114:Rusc2 UTSW 4 43422055 missense probably damaging 1.00
R0255:Rusc2 UTSW 4 43423954 missense probably damaging 1.00
R0471:Rusc2 UTSW 4 43425486 missense probably damaging 0.99
R1381:Rusc2 UTSW 4 43416137 missense probably damaging 1.00
R1413:Rusc2 UTSW 4 43416568 missense probably benign 0.00
R1416:Rusc2 UTSW 4 43421617 missense possibly damaging 0.86
R1731:Rusc2 UTSW 4 43426046 missense probably benign
R1864:Rusc2 UTSW 4 43421719 missense possibly damaging 0.49
R1897:Rusc2 UTSW 4 43421749 missense probably damaging 1.00
R2010:Rusc2 UTSW 4 43415212 missense probably benign 0.06
R2212:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R2275:Rusc2 UTSW 4 43416260 missense probably damaging 1.00
R2885:Rusc2 UTSW 4 43415456 missense probably benign 0.28
R2886:Rusc2 UTSW 4 43415456 missense probably benign 0.28
R3412:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3413:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3414:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3852:Rusc2 UTSW 4 43416424 missense probably benign 0.45
R4135:Rusc2 UTSW 4 43425563 missense possibly damaging 0.49
R4272:Rusc2 UTSW 4 43415533 missense probably damaging 1.00
R4574:Rusc2 UTSW 4 43416080 missense probably damaging 0.99
R4888:Rusc2 UTSW 4 43423942 missense probably damaging 1.00
R5010:Rusc2 UTSW 4 43415926 missense probably damaging 1.00
R5071:Rusc2 UTSW 4 43415240 missense probably benign 0.05
R5131:Rusc2 UTSW 4 43414948 missense probably benign 0.03
R5177:Rusc2 UTSW 4 43421805 splice site probably null
R5540:Rusc2 UTSW 4 43423975 missense probably damaging 1.00
R5561:Rusc2 UTSW 4 43415932 nonsense probably null
R5628:Rusc2 UTSW 4 43425348 missense probably damaging 1.00
R5645:Rusc2 UTSW 4 43425758 missense probably benign 0.06
R6129:Rusc2 UTSW 4 43424271 missense probably damaging 1.00
R6362:Rusc2 UTSW 4 43416416 missense probably benign 0.30
R6633:Rusc2 UTSW 4 43414852 missense probably damaging 0.99
R6980:Rusc2 UTSW 4 43422846 missense probably benign 0.35
R7491:Rusc2 UTSW 4 43426528 missense probably damaging 1.00
R7641:Rusc2 UTSW 4 43425335 missense possibly damaging 0.84
R7698:Rusc2 UTSW 4 43414900 nonsense probably null
R7710:Rusc2 UTSW 4 43416119 missense probably benign 0.07
R8052:Rusc2 UTSW 4 43421851 missense probably benign
R8061:Rusc2 UTSW 4 43422492 missense probably damaging 1.00
R8127:Rusc2 UTSW 4 43423747 missense possibly damaging 0.54
R8319:Rusc2 UTSW 4 43425378 missense probably damaging 1.00
R8355:Rusc2 UTSW 4 43422846 missense probably benign 0.35
R8397:Rusc2 UTSW 4 43424206 missense possibly damaging 0.95
R8455:Rusc2 UTSW 4 43422846 missense probably benign 0.35
R8553:Rusc2 UTSW 4 43416508 missense probably benign 0.05
R8725:Rusc2 UTSW 4 43401351 intron probably benign
R8727:Rusc2 UTSW 4 43401351 intron probably benign
X0025:Rusc2 UTSW 4 43422226 missense probably benign 0.00
X0066:Rusc2 UTSW 4 43422204 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACTCACAGTCGACCTGGAGTG -3'
(R):5'- ACAGAGTTGAGGTTGGCAC -3'

Sequencing Primer
(F):5'- CGACCTGGAGTGGTGGAG -3'
(R):5'- ACGGGAGCTGCTGTGCATC -3'
Posted On2021-04-30