Incidental Mutation 'R8725:Olfr541'
ID 673189
Institutional Source Beutler Lab
Gene Symbol Olfr541
Ensembl Gene ENSMUSG00000057997
Gene Name olfactory receptor 541
Synonyms GA_x6K02T2PBJ9-42850324-42851256, MOR253-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock # R8725 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 140697267-140705606 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 140704694 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 148 (V148L)
Ref Sequence ENSEMBL: ENSMUSP00000148238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080681] [ENSMUST00000209857] [ENSMUST00000210357]
AlphaFold Q8VGM0
Predicted Effect probably benign
Transcript: ENSMUST00000080681
AA Change: V148L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079508
Gene: ENSMUSG00000057997
AA Change: V148L

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 2.2e-49 PFAM
Pfam:7TM_GPCR_Srsx 37 180 5e-8 PFAM
Pfam:7tm_1 43 292 1.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209857
Predicted Effect probably benign
Transcript: ENSMUST00000210357
AA Change: V148L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T A 14: 103,049,639 W69R probably damaging Het
Adamtsl4 C T 3: 95,677,116 R990Q possibly damaging Het
Ahdc1 T A 4: 133,065,432 V1328E possibly damaging Het
Bpifb2 A G 2: 153,889,436 H244R possibly damaging Het
C87414 A T 5: 93,636,457 Y383N probably damaging Het
Camk1 C A 6: 113,338,148 V199L probably damaging Het
Ccdc18 A T 5: 108,180,417 K661I possibly damaging Het
Cdh16 C T 8: 104,618,242 V444I probably benign Het
Cep295 A T 9: 15,332,419 Y1580* probably null Het
Cntnap5c A T 17: 58,055,668 N339Y probably damaging Het
Col6a3 C G 1: 90,767,606 probably benign Het
Deup1 T A 9: 15,592,425 D280V probably damaging Het
Dlat G T 9: 50,649,667 A360E probably damaging Het
Evpl T A 11: 116,222,193 D1557V probably benign Het
Ext1 A G 15: 53,344,669 V232A possibly damaging Het
Gdpd5 T C 7: 99,456,519 I514T possibly damaging Het
Gm14443 A T 2: 175,168,900 C584* probably null Het
Gm2696 T A 10: 77,836,200 C78S unknown Het
Gm4131 T C 14: 62,463,851 D276G possibly damaging Het
Gm5114 C T 7: 39,411,233 G64D probably benign Het
Gm5861 A T 5: 11,186,441 Q147L probably benign Het
Gsx2 G T 5: 75,076,094 A112S probably benign Het
Hebp1 G T 6: 135,137,921 R181S probably damaging Het
Hectd4 G A 5: 121,350,494 G3616D probably damaging Het
Hemgn T G 4: 46,394,638 T491P probably benign Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Itsn1 T C 16: 91,839,833 S723P unknown Het
Kat6a G A 8: 22,908,277 G287D probably damaging Het
Ktn1 T G 14: 47,670,300 probably benign Het
Lrrc56 C A 7: 141,198,333 D79E possibly damaging Het
Lrrn1 C T 6: 107,567,342 Q34* probably null Het
Mlxipl A G 5: 135,128,629 M340V probably benign Het
Mroh6 T C 15: 75,884,714 T604A possibly damaging Het
Olfr1228 A T 2: 89,249,314 S115T probably benign Het
Olfr351 T A 2: 36,859,598 Y250F probably damaging Het
Palb2 A C 7: 122,111,661 V1022G unknown Het
Pank1 T G 19: 34,878,589 H163P possibly damaging Het
Pcdha12 A G 18: 37,021,683 Q485R probably benign Het
Pcdhb15 T A 18: 37,475,681 S655R probably damaging Het
Pcdhgb1 T A 18: 37,681,414 C319* probably null Het
Pipox A T 11: 77,883,978 L93* probably null Het
Pkd1l1 A C 11: 8,961,482 V265G Het
Pld3 G A 7: 27,539,654 Q149* probably null Het
Prpf3 T A 3: 95,840,709 T415S possibly damaging Het
Rasgef1b G A 5: 99,300,036 T105I unknown Het
Rere G T 4: 150,617,335 E24* probably null Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Ric3 A T 7: 109,038,717 D277E probably benign Het
Rnf44 A T 13: 54,684,013 M82K probably damaging Het
Rsph14 T C 10: 74,959,684 N223S probably benign Het
Rusc2 A G 4: 43,415,396 E234G probably damaging Het
Scfd2 T C 5: 74,482,239 N349S probably benign Het
Sema3d G A 5: 12,505,855 C183Y probably damaging Het
Setd2 T C 9: 110,573,844 I74T Het
Slc39a12 T C 2: 14,449,859 S563P probably damaging Het
Slc9a8 A T 2: 167,473,534 D526V probably damaging Het
Smpdl3b G T 4: 132,733,749 T339N probably damaging Het
Spi1 G A 2: 91,115,171 G199D probably damaging Het
Stx2 T C 5: 128,993,500 T118A probably damaging Het
Synj2 C A 17: 6,037,740 S1355R possibly damaging Het
Taf15 A G 11: 83,499,138 T245A probably benign Het
Tnrc6b C T 15: 80,876,452 A120V probably damaging Het
Usp19 G T 9: 108,493,735 G198W probably damaging Het
Wdtc1 G T 4: 133,313,803 H46N probably damaging Het
Zbtb1 C A 12: 76,385,872 R211S probably damaging Het
Zc3h8 A G 2: 128,933,287 V151A probably benign Het
Zfp219 T C 14: 52,007,442 T499A possibly damaging Het
Zfp689 A G 7: 127,448,768 F31L probably damaging Het
Zfp879 C T 11: 50,838,494 D26N probably damaging Het
Other mutations in Olfr541
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Olfr541 APN 7 140704437 missense probably damaging 1.00
IGL01872:Olfr541 APN 7 140704263 missense possibly damaging 0.59
IGL02814:Olfr541 APN 7 140705133 missense probably damaging 1.00
R0690:Olfr541 UTSW 7 140704787 missense possibly damaging 0.88
R1019:Olfr541 UTSW 7 140704494 missense probably damaging 1.00
R1665:Olfr541 UTSW 7 140704794 missense probably damaging 1.00
R1696:Olfr541 UTSW 7 140704496 nonsense probably null
R4065:Olfr541 UTSW 7 140704269 missense probably benign
R4517:Olfr541 UTSW 7 140705091 missense probably damaging 1.00
R5549:Olfr541 UTSW 7 140704799 splice site probably null
R6327:Olfr541 UTSW 7 140704703 missense probably damaging 1.00
R7288:Olfr541 UTSW 7 140705029 nonsense probably null
R7307:Olfr541 UTSW 7 140705147 missense probably benign 0.39
R7454:Olfr541 UTSW 7 140704634 missense probably damaging 1.00
R9404:Olfr541 UTSW 7 140704809 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGAAAACACCATCTCCTTC -3'
(R):5'- TGTAGCCATAGGACAACAGTG -3'

Sequencing Primer
(F):5'- TTCAAAGGATGCATGGCCC -3'
(R):5'- TAGCACGAAGTTGATGCCTC -3'
Posted On 2021-04-30