Incidental Mutation 'R8725:Tnrc6b'
ID 673213
Institutional Source Beutler Lab
Gene Symbol Tnrc6b
Ensembl Gene ENSMUSG00000047888
Gene Name trinucleotide repeat containing 6b
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock # R8725 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 80711313-80941085 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 80876452 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 120 (A120V)
Ref Sequence ENSEMBL: ENSMUSP00000064336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067689]
AlphaFold Q8BKI2
Predicted Effect probably damaging
Transcript: ENSMUST00000067689
AA Change: A120V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: A120V

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
coiled coil region 33 72 N/A INTRINSIC
low complexity region 88 106 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 363 380 N/A INTRINSIC
low complexity region 416 425 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
internal_repeat_1 488 667 6.43e-5 PROSPERO
low complexity region 858 888 N/A INTRINSIC
Pfam:Ago_hook 955 1095 1.2e-28 PFAM
coiled coil region 1258 1307 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1339 1623 2.8e-112 PFAM
Pfam:RRM_5 1641 1695 2e-7 PFAM
low complexity region 1705 1721 N/A INTRINSIC
low complexity region 1748 1769 N/A INTRINSIC
low complexity region 1792 1809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228124
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T A 14: 103,049,639 W69R probably damaging Het
Adamtsl4 C T 3: 95,677,116 R990Q possibly damaging Het
Ahdc1 T A 4: 133,065,432 V1328E possibly damaging Het
Bpifb2 A G 2: 153,889,436 H244R possibly damaging Het
C87414 A T 5: 93,636,457 Y383N probably damaging Het
Camk1 C A 6: 113,338,148 V199L probably damaging Het
Ccdc18 A T 5: 108,180,417 K661I possibly damaging Het
Cdh16 C T 8: 104,618,242 V444I probably benign Het
Cep295 A T 9: 15,332,419 Y1580* probably null Het
Cntnap5c A T 17: 58,055,668 N339Y probably damaging Het
Col6a3 C G 1: 90,767,606 probably benign Het
Deup1 T A 9: 15,592,425 D280V probably damaging Het
Dlat G T 9: 50,649,667 A360E probably damaging Het
Evpl T A 11: 116,222,193 D1557V probably benign Het
Ext1 A G 15: 53,344,669 V232A possibly damaging Het
Gdpd5 T C 7: 99,456,519 I514T possibly damaging Het
Gm14443 A T 2: 175,168,900 C584* probably null Het
Gm2696 T A 10: 77,836,200 C78S unknown Het
Gm4131 T C 14: 62,463,851 D276G possibly damaging Het
Gm5114 C T 7: 39,411,233 G64D probably benign Het
Gm5861 A T 5: 11,186,441 Q147L probably benign Het
Gsx2 G T 5: 75,076,094 A112S probably benign Het
Hebp1 G T 6: 135,137,921 R181S probably damaging Het
Hectd4 G A 5: 121,350,494 G3616D probably damaging Het
Hemgn T G 4: 46,394,638 T491P probably benign Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Itsn1 T C 16: 91,839,833 S723P unknown Het
Kat6a G A 8: 22,908,277 G287D probably damaging Het
Ktn1 T G 14: 47,670,300 probably benign Het
Lrrc56 C A 7: 141,198,333 D79E possibly damaging Het
Lrrn1 C T 6: 107,567,342 Q34* probably null Het
Mlxipl A G 5: 135,128,629 M340V probably benign Het
Mroh6 T C 15: 75,884,714 T604A possibly damaging Het
Olfr1228 A T 2: 89,249,314 S115T probably benign Het
Olfr351 T A 2: 36,859,598 Y250F probably damaging Het
Olfr541 G T 7: 140,704,694 V148L probably benign Het
Palb2 A C 7: 122,111,661 V1022G unknown Het
Pank1 T G 19: 34,878,589 H163P possibly damaging Het
Pcdha12 A G 18: 37,021,683 Q485R probably benign Het
Pcdhb15 T A 18: 37,475,681 S655R probably damaging Het
Pcdhgb1 T A 18: 37,681,414 C319* probably null Het
Pipox A T 11: 77,883,978 L93* probably null Het
Pkd1l1 A C 11: 8,961,482 V265G Het
Pld3 G A 7: 27,539,654 Q149* probably null Het
Prpf3 T A 3: 95,840,709 T415S possibly damaging Het
Rasgef1b G A 5: 99,300,036 T105I unknown Het
Rere G T 4: 150,617,335 E24* probably null Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Ric3 A T 7: 109,038,717 D277E probably benign Het
Rnf44 A T 13: 54,684,013 M82K probably damaging Het
Rsph14 T C 10: 74,959,684 N223S probably benign Het
Rusc2 A G 4: 43,415,396 E234G probably damaging Het
Scfd2 T C 5: 74,482,239 N349S probably benign Het
Sema3d G A 5: 12,505,855 C183Y probably damaging Het
Setd2 T C 9: 110,573,844 I74T Het
Slc39a12 T C 2: 14,449,859 S563P probably damaging Het
Slc9a8 A T 2: 167,473,534 D526V probably damaging Het
Smpdl3b G T 4: 132,733,749 T339N probably damaging Het
Spi1 G A 2: 91,115,171 G199D probably damaging Het
Stx2 T C 5: 128,993,500 T118A probably damaging Het
Synj2 C A 17: 6,037,740 S1355R possibly damaging Het
Taf15 A G 11: 83,499,138 T245A probably benign Het
Usp19 G T 9: 108,493,735 G198W probably damaging Het
Wdtc1 G T 4: 133,313,803 H46N probably damaging Het
Zbtb1 C A 12: 76,385,872 R211S probably damaging Het
Zc3h8 A G 2: 128,933,287 V151A probably benign Het
Zfp219 T C 14: 52,007,442 T499A possibly damaging Het
Zfp689 A G 7: 127,448,768 F31L probably damaging Het
Zfp879 C T 11: 50,838,494 D26N probably damaging Het
Other mutations in Tnrc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Tnrc6b APN 15 80923578 missense probably damaging 1.00
IGL01402:Tnrc6b APN 15 80880544 missense possibly damaging 0.71
IGL01505:Tnrc6b APN 15 80879963 missense probably benign 0.00
IGL01516:Tnrc6b APN 15 80902622 missense possibly damaging 0.93
IGL01584:Tnrc6b APN 15 80879682 missense probably benign 0.01
IGL01681:Tnrc6b APN 15 80879311 splice site probably null
IGL01909:Tnrc6b APN 15 80901983 missense possibly damaging 0.88
IGL01943:Tnrc6b APN 15 80927695 nonsense probably null
IGL02253:Tnrc6b APN 15 80876541 missense probably damaging 0.99
IGL02260:Tnrc6b APN 15 80880171 missense probably damaging 0.99
IGL02437:Tnrc6b APN 15 80880457 missense probably damaging 1.00
IGL02541:Tnrc6b APN 15 80879831 missense probably benign 0.00
IGL02542:Tnrc6b APN 15 80902352 missense possibly damaging 0.83
grosser UTSW 15 80929285 missense probably damaging 1.00
heiliger UTSW 15 80927741 critical splice donor site probably null
PIT1430001:Tnrc6b UTSW 15 80929186 missense probably damaging 0.99
R0092:Tnrc6b UTSW 15 80918528 missense probably damaging 1.00
R0165:Tnrc6b UTSW 15 80858670 splice site probably null
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0257:Tnrc6b UTSW 15 80894355 missense possibly damaging 0.80
R0418:Tnrc6b UTSW 15 80913323 missense probably benign 0.27
R0432:Tnrc6b UTSW 15 80923446 splice site probably benign
R0487:Tnrc6b UTSW 15 80880675 missense probably benign 0.01
R0498:Tnrc6b UTSW 15 80858719 missense probably damaging 0.98
R0528:Tnrc6b UTSW 15 80879403 missense probably benign 0.00
R0533:Tnrc6b UTSW 15 80876653 missense probably benign 0.00
R0571:Tnrc6b UTSW 15 80913338 missense probably damaging 1.00
R0650:Tnrc6b UTSW 15 80784758 missense probably benign 0.33
R0659:Tnrc6b UTSW 15 80923446 splice site probably benign
R0884:Tnrc6b UTSW 15 80902555 small deletion probably benign
R1131:Tnrc6b UTSW 15 80894453 missense possibly damaging 0.45
R1188:Tnrc6b UTSW 15 80879229 missense probably benign
R1479:Tnrc6b UTSW 15 80887032 splice site probably null
R1564:Tnrc6b UTSW 15 80880168 missense possibly damaging 0.95
R1645:Tnrc6b UTSW 15 80882958 missense probably damaging 0.99
R1924:Tnrc6b UTSW 15 80884206 critical splice acceptor site probably null
R1926:Tnrc6b UTSW 15 80881162 missense probably damaging 1.00
R1928:Tnrc6b UTSW 15 80880723 missense probably damaging 1.00
R1965:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R1966:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R2072:Tnrc6b UTSW 15 80882965 missense possibly damaging 0.89
R3084:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3552:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3736:Tnrc6b UTSW 15 80889163 splice site probably benign
R3791:Tnrc6b UTSW 15 80923640 missense probably damaging 1.00
R4170:Tnrc6b UTSW 15 80916787 missense probably benign 0.24
R4276:Tnrc6b UTSW 15 80901971 missense probably benign 0.42
R4519:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R5380:Tnrc6b UTSW 15 80879565 missense possibly damaging 0.56
R5470:Tnrc6b UTSW 15 80916711 missense possibly damaging 0.89
R5590:Tnrc6b UTSW 15 80876502 missense probably damaging 0.98
R5982:Tnrc6b UTSW 15 80880816 missense probably benign
R6269:Tnrc6b UTSW 15 80880743 missense probably benign 0.42
R6331:Tnrc6b UTSW 15 80879614 missense probably benign 0.00
R6484:Tnrc6b UTSW 15 80879324 missense possibly damaging 0.92
R6622:Tnrc6b UTSW 15 80879184 missense probably damaging 0.99
R6695:Tnrc6b UTSW 15 80879773 missense probably damaging 1.00
R6728:Tnrc6b UTSW 15 80918526 missense probably damaging 1.00
R6776:Tnrc6b UTSW 15 80924119 missense possibly damaging 0.87
R7159:Tnrc6b UTSW 15 80887022 missense possibly damaging 0.92
R7210:Tnrc6b UTSW 15 80929285 missense probably damaging 1.00
R7287:Tnrc6b UTSW 15 80879541 missense possibly damaging 0.83
R7402:Tnrc6b UTSW 15 80884300 missense probably damaging 1.00
R7479:Tnrc6b UTSW 15 80889126 missense probably benign 0.13
R7533:Tnrc6b UTSW 15 80927741 critical splice donor site probably null
R7571:Tnrc6b UTSW 15 80929393 missense probably benign
R7594:Tnrc6b UTSW 15 80880307 missense possibly damaging 0.66
R7831:Tnrc6b UTSW 15 80880379 missense possibly damaging 0.49
R8208:Tnrc6b UTSW 15 80858700 missense possibly damaging 0.53
R8276:Tnrc6b UTSW 15 80880717 missense probably benign 0.00
R8295:Tnrc6b UTSW 15 80913364 missense probably damaging 1.00
R8351:Tnrc6b UTSW 15 80923490 missense probably damaging 0.99
R8423:Tnrc6b UTSW 15 80929418 missense unknown
R8451:Tnrc6b UTSW 15 80923490 missense probably damaging 0.99
R8872:Tnrc6b UTSW 15 80918089 missense probably benign 0.23
R9029:Tnrc6b UTSW 15 80878978 missense possibly damaging 0.83
R9057:Tnrc6b UTSW 15 80879148 missense probably benign
R9240:Tnrc6b UTSW 15 80880061 missense probably damaging 0.98
R9450:Tnrc6b UTSW 15 80880436 missense probably benign 0.01
X0020:Tnrc6b UTSW 15 80882997 missense probably benign 0.16
X0025:Tnrc6b UTSW 15 80881167 missense probably benign 0.03
Z1088:Tnrc6b UTSW 15 80927690 nonsense probably null
Z1177:Tnrc6b UTSW 15 80858699 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AAGCCTGTCCTTTGAGAACAAAATG -3'
(R):5'- AAAGGATCGCTCTCCTGCTG -3'

Sequencing Primer
(F):5'- CTGTCCTTTGAGAACAAAATGTAAGC -3'
(R):5'- ACTCTCACTCTGCAGCAGCG -3'
Posted On 2021-04-30