Incidental Mutation 'R8671:Npr1'
ID 673234
Institutional Source Beutler Lab
Gene Symbol Npr1
Ensembl Gene ENSMUSG00000027931
Gene Name natriuretic peptide receptor 1
Synonyms guanylyl cyclase-A, NPRA, NPR-A, GC-A
MMRRC Submission 068526-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R8671 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 90357898-90373173 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) A to T at 90363464 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000029540]
AlphaFold P18293
Predicted Effect probably benign
Transcript: ENSMUST00000029540
SMART Domains Protein: ENSMUSP00000029540
Gene: ENSMUSG00000027931

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 50 410 4.7e-54 PFAM
low complexity region 468 488 N/A INTRINSIC
Pfam:Pkinase_Tyr 538 797 1.2e-39 PFAM
Pfam:Pkinase 543 796 8.7e-31 PFAM
CYCc 836 1030 5.04e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124760
SMART Domains Protein: ENSMUSP00000118023
Gene: ENSMUSG00000027931

DomainStartEndE-ValueType
PDB:3A3K|B 2 20 1e-8 PDB
transmembrane domain 25 47 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanylyl cyclases, catalyzing the production of cGMP from GTP, are classified as soluble and membrane forms (Garbers and Lowe, 1994 [PubMed 7982997]). The membrane guanylyl cyclases, often termed guanylyl cyclases A through F, form a family of cell-surface receptors with a similar topographic structure: an extracellular ligand-binding domain, a single membrane-spanning domain, and an intracellular region that contains a protein kinase-like domain and a cyclase catalytic domain. GC-A and GC-B function as receptors for natriuretic peptides; they are also referred to as atrial natriuretic peptide receptor A (NPR1) and type B (NPR2; MIM 108961). Also see NPR3 (MIM 108962), which encodes a protein with only the ligand-binding transmembrane and 37-amino acid cytoplasmic domains. NPR1 is a membrane-bound guanylate cyclase that serves as the receptor for both atrial and brain natriuretic peptides (ANP (MIM 108780) and BNP (MIM 600295), respectively).[supplied by OMIM, May 2009]
PHENOTYPE: Homozygous inactivation of this gene can lead to hypertension, cardiac hypertrophy, lethal vascular events, congestive heart failure in response to volume overload, reduced serum testosterone levels, altered steroidogenesis, and reduced myocardial PMN infiltration and infarct size after I/R injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C T 4: 73,861,166 (GRCm39) E145K probably damaging Het
Ambp A T 4: 63,068,656 (GRCm39) Y120* probably null Het
Ankrd36 C T 11: 5,579,312 (GRCm39) A192V probably benign Het
Apol7e A T 15: 77,601,803 (GRCm39) M134L probably benign Het
Atg9b A T 5: 24,591,107 (GRCm39) N774K probably benign Het
Catsperb T A 12: 101,560,596 (GRCm39) N862K possibly damaging Het
Ccdc7a T A 8: 129,646,948 (GRCm39) D648V probably damaging Het
Cfap54 G T 10: 92,790,934 (GRCm39) P1855T unknown Het
Clcnkb T A 4: 141,139,541 (GRCm39) T154S probably damaging Het
Cux1 C T 5: 136,279,454 (GRCm39) R609H probably damaging Het
Eif2ak4 A G 2: 118,252,667 (GRCm39) D413G possibly damaging Het
Elp1 A G 4: 56,771,453 (GRCm39) L948P probably damaging Het
Flnc T C 6: 29,443,501 (GRCm39) probably null Het
Grm5 T C 7: 87,765,498 (GRCm39) probably null Het
Hectd3 T G 4: 116,853,778 (GRCm39) F225V possibly damaging Het
Hpcal4 G T 4: 123,082,976 (GRCm39) M107I probably benign Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Larp4 C A 15: 99,908,339 (GRCm39) Q607K probably benign Het
Marchf8 A G 6: 116,378,815 (GRCm39) R250G probably benign Het
Med13 A C 11: 86,161,923 (GRCm39) N2135K probably damaging Het
Msh5 T A 17: 35,264,909 (GRCm39) R89* probably null Het
Musk T G 4: 58,286,051 (GRCm39) probably benign Het
Myo18b T C 5: 113,022,609 (GRCm39) Q261R unknown Het
Nynrin T A 14: 56,107,899 (GRCm39) V1002E possibly damaging Het
Or2l5 T C 16: 19,333,804 (GRCm39) Y194C possibly damaging Het
Or4c103 A T 2: 88,513,449 (GRCm39) F209Y probably benign Het
Or4f14c T A 2: 111,941,333 (GRCm39) K88M probably damaging Het
Or5w15 A T 2: 87,567,990 (GRCm39) L226Q probably damaging Het
Pcare G T 17: 72,058,372 (GRCm39) A435E probably benign Het
Pcdh9 T C 14: 94,126,086 (GRCm39) Y28C probably damaging Het
Pmpca G C 2: 26,285,046 (GRCm39) E424Q possibly damaging Het
Potefam1 T C 2: 111,059,877 (GRCm39) probably benign Het
Potefam3e T A 8: 19,784,775 (GRCm39) L203* probably null Het
Prkd1 T A 12: 50,435,191 (GRCm39) N512I probably benign Het
Pwwp2b C T 7: 138,836,326 (GRCm39) P589L probably damaging Het
Rasgrp4 G A 7: 28,842,452 (GRCm39) G242D probably damaging Het
Rcbtb1 T G 14: 59,467,973 (GRCm39) V480G probably damaging Het
Rptn A G 3: 93,305,501 (GRCm39) S945G probably benign Het
Slc22a2 C T 17: 12,824,863 (GRCm39) Q242* probably null Het
Slfn3 T A 11: 83,103,825 (GRCm39) V232E probably benign Het
Stab1 T A 14: 30,879,365 (GRCm39) K705M probably damaging Het
Syn2 C A 6: 115,255,128 (GRCm39) S480* probably null Het
Thsd4 A T 9: 60,301,728 (GRCm39) L189H probably damaging Het
Tinagl1 T C 4: 130,061,597 (GRCm39) T250A probably benign Het
Tnc A T 4: 63,935,683 (GRCm39) C418S probably damaging Het
Ube2q1 A G 3: 89,683,385 (GRCm39) E110G probably damaging Het
Wdfy4 G T 14: 32,693,722 (GRCm39) probably benign Het
Xcl1 T C 1: 164,759,419 (GRCm39) M94V probably benign Het
Zfp369 T C 13: 65,444,095 (GRCm39) S413P possibly damaging Het
Zfp454 A C 11: 50,764,595 (GRCm39) I279S possibly damaging Het
Zfp971 A C 2: 177,675,730 (GRCm39) Q443P probably damaging Het
Other mutations in Npr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Npr1 APN 3 90,365,669 (GRCm39) missense probably damaging 1.00
IGL01432:Npr1 APN 3 90,370,543 (GRCm39) missense possibly damaging 0.85
IGL02106:Npr1 APN 3 90,372,165 (GRCm39) missense probably benign 0.12
IGL03310:Npr1 APN 3 90,363,298 (GRCm39) missense probably benign 0.30
PIT4581001:Npr1 UTSW 3 90,369,564 (GRCm39) missense probably damaging 1.00
R0010:Npr1 UTSW 3 90,362,139 (GRCm39) missense probably damaging 1.00
R0137:Npr1 UTSW 3 90,363,244 (GRCm39) missense probably damaging 1.00
R0384:Npr1 UTSW 3 90,372,474 (GRCm39) missense probably damaging 0.98
R0656:Npr1 UTSW 3 90,368,676 (GRCm39) missense probably benign
R0941:Npr1 UTSW 3 90,368,716 (GRCm39) missense probably benign
R0961:Npr1 UTSW 3 90,366,028 (GRCm39) missense possibly damaging 0.91
R1172:Npr1 UTSW 3 90,368,689 (GRCm39) missense probably benign 0.01
R1747:Npr1 UTSW 3 90,365,976 (GRCm39) missense possibly damaging 0.88
R1763:Npr1 UTSW 3 90,366,644 (GRCm39) missense probably damaging 0.98
R1900:Npr1 UTSW 3 90,369,495 (GRCm39) missense probably damaging 0.98
R3807:Npr1 UTSW 3 90,366,033 (GRCm39) missense probably damaging 0.98
R4017:Npr1 UTSW 3 90,363,539 (GRCm39) missense probably damaging 1.00
R4437:Npr1 UTSW 3 90,363,593 (GRCm39) missense probably damaging 1.00
R4900:Npr1 UTSW 3 90,363,272 (GRCm39) missense possibly damaging 0.77
R5265:Npr1 UTSW 3 90,364,309 (GRCm39) missense probably benign 0.29
R5343:Npr1 UTSW 3 90,365,515 (GRCm39) missense possibly damaging 0.94
R5590:Npr1 UTSW 3 90,362,149 (GRCm39) missense probably damaging 0.99
R5868:Npr1 UTSW 3 90,366,800 (GRCm39) intron probably benign
R6782:Npr1 UTSW 3 90,363,560 (GRCm39) missense probably benign 0.18
R6828:Npr1 UTSW 3 90,372,120 (GRCm39) missense probably benign
R6903:Npr1 UTSW 3 90,362,452 (GRCm39) missense possibly damaging 0.67
R7592:Npr1 UTSW 3 90,372,323 (GRCm39) missense possibly damaging 0.52
R7841:Npr1 UTSW 3 90,362,175 (GRCm39) missense probably damaging 1.00
R8202:Npr1 UTSW 3 90,368,731 (GRCm39) missense probably benign
R8683:Npr1 UTSW 3 90,362,497 (GRCm39) missense probably benign 0.38
R8819:Npr1 UTSW 3 90,372,201 (GRCm39) missense probably damaging 0.96
R8820:Npr1 UTSW 3 90,372,201 (GRCm39) missense probably damaging 0.96
R9330:Npr1 UTSW 3 90,365,979 (GRCm39) missense possibly damaging 0.85
R9680:Npr1 UTSW 3 90,368,448 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCAAATGCCTCAGCCTGGAC -3'
(R):5'- GCCAGGAAGAACCAGTCATC -3'

Sequencing Primer
(F):5'- TCAGCCTGGACTGTCTCG -3'
(R):5'- GGAAGAACCAGTCATCCCATCTC -3'
Posted On 2021-05-28