Incidental Mutation 'R8676:Hnf4g'
ID673238
Institutional Source Beutler Lab
Gene Symbol Hnf4g
Ensembl Gene ENSMUSG00000017688
Gene Namehepatocyte nuclear factor 4, gamma
SynonymsNR2A2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R8676 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location3508030-3658052 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 3643073 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108393] [ENSMUST00000108394]
Predicted Effect probably benign
Transcript: ENSMUST00000108393
SMART Domains Protein: ENSMUSP00000104030
Gene: ENSMUSG00000017688

DomainStartEndE-ValueType
ZnF_C4 9 80 6.51e-35 SMART
low complexity region 118 125 N/A INTRINSIC
HOLI 141 299 7.29e-47 SMART
low complexity region 334 345 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108394
SMART Domains Protein: ENSMUSP00000104031
Gene: ENSMUSG00000017688

DomainStartEndE-ValueType
ZnF_C4 63 134 6.51e-35 SMART
low complexity region 172 179 N/A INTRINSIC
HOLI 195 353 7.29e-47 SMART
low complexity region 388 399 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (54/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are less inclined to build nests, spend more time in a passive state during the forced swim test, and display a reduction in energy expenditure and night time activity that results in increased body weight despite adecreased intake of food and water. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik A G 4: 107,895,599 N152D unknown Het
1700021F05Rik A G 10: 43,532,937 L70S probably benign Het
Acsm3 T A 7: 119,775,169 S281R probably damaging Het
Adipor2 G T 6: 119,363,486 probably benign Het
Alk T C 17: 71,897,941 S1079G probably damaging Het
Ankrd27 T C 7: 35,602,584 probably null Het
Anxa6 C A 11: 55,001,282 E283* probably null Het
Bnc2 T C 4: 84,276,313 H858R possibly damaging Het
Btnl6 T C 17: 34,508,069 S496G probably benign Het
Ccdc88a T C 11: 29,460,860 S449P probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cfap43 A T 19: 47,748,017 L1345H possibly damaging Het
Cyld A T 8: 88,729,510 H396L probably benign Het
Cyp20a1 A G 1: 60,379,420 T340A possibly damaging Het
Dera A T 6: 137,830,204 I217F probably damaging Het
Dnah11 A G 12: 118,190,804 L247P probably damaging Het
Eftud2 G A 11: 102,868,621 T152M probably damaging Het
Epb41l2 C T 10: 25,443,776 T169M probably benign Het
Fam186a T C 15: 99,947,142 D407G unknown Het
Fam189a2 T C 19: 23,988,494 K214E probably damaging Het
Gli3 T A 13: 15,715,034 C578S probably damaging Het
Gm436 G A 4: 144,670,113 R350C possibly damaging Het
Gm6408 A G 5: 146,482,427 N84S probably benign Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Herc2 C A 7: 56,188,613 T3296K probably damaging Het
Hyal4 C A 6: 24,755,827 Q15K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcna3 A G 3: 107,036,592 E57G probably damaging Het
Kcnc3 C A 7: 44,591,596 D237E probably benign Het
Map3k8 A G 18: 4,343,137 V130A probably benign Het
Mpp7 A G 18: 7,440,430 probably null Het
Myh13 T A 11: 67,342,485 L610Q probably damaging Het
Olfr1020 T A 2: 85,849,902 M150K probably benign Het
Olfr1339 C A 4: 118,735,038 P170T probably damaging Het
Olfr917 T C 9: 38,665,768 I25M probably benign Het
Pcdhb5 A T 18: 37,321,076 T170S probably benign Het
Polr3b T A 10: 84,680,387 H626Q probably benign Het
Prkg1 A T 19: 31,764,746 L26Q probably damaging Het
Prob1 T C 18: 35,653,986 N405S possibly damaging Het
Proz T G 8: 13,073,630 S300R probably damaging Het
Psg19 A G 7: 18,794,065 I251T probably benign Het
Rcbtb1 T C 14: 59,229,952 I413T possibly damaging Het
Rnf144b T A 13: 47,228,976 Y103N probably damaging Het
Rspry1 G C 8: 94,632,119 G194R probably benign Het
Scn2b A G 9: 45,125,619 I142V probably damaging Het
Spata20 A T 11: 94,481,781 L588H probably damaging Het
Stk32b T A 5: 37,457,159 H335L probably benign Het
Taar4 A C 10: 23,960,903 D137A possibly damaging Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tek A T 4: 94,849,837 H708L probably benign Het
Tmem89 C T 9: 108,915,027 L132F unknown Het
Ugt2b38 T C 5: 87,411,822 I404V probably benign Het
Vmn1r16 C T 6: 57,322,829 M269I probably benign Het
Vmn1r201 A G 13: 22,475,252 K212R probably damaging Het
Vmn2r11 A C 5: 109,053,760 F293V probably damaging Het
Zdhhc17 A T 10: 110,962,379 probably benign Het
Zfp423 C A 8: 87,782,710 M335I probably benign Het
Zfp74 T C 7: 29,934,654 Y543C probably damaging Het
Zfp975 A T 7: 42,662,840 S116R probably benign Het
Other mutations in Hnf4g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hnf4g APN 3 3648082 missense probably benign
IGL00832:Hnf4g APN 3 3641276 missense probably damaging 1.00
IGL01571:Hnf4g APN 3 3651266 splice site probably benign
IGL01896:Hnf4g APN 3 3651410 missense probably damaging 1.00
IGL02068:Hnf4g APN 3 3644576 missense probably benign
IGL03040:Hnf4g APN 3 3634211 utr 5 prime probably benign
IGL03097:Hnf4g UTSW 3 3651614 missense probably damaging 1.00
R0124:Hnf4g UTSW 3 3643082 splice site probably benign
R0477:Hnf4g UTSW 3 3651791 splice site probably benign
R0512:Hnf4g UTSW 3 3651622 missense probably damaging 1.00
R0744:Hnf4g UTSW 3 3651629 missense possibly damaging 0.92
R1323:Hnf4g UTSW 3 3634221 missense possibly damaging 0.73
R1323:Hnf4g UTSW 3 3634221 missense possibly damaging 0.73
R1656:Hnf4g UTSW 3 3652951 missense probably benign
R1982:Hnf4g UTSW 3 3638208 missense probably damaging 0.99
R2336:Hnf4g UTSW 3 3641224 missense probably benign 0.25
R3104:Hnf4g UTSW 3 3652856 missense probably benign 0.42
R3105:Hnf4g UTSW 3 3652856 missense probably benign 0.42
R3106:Hnf4g UTSW 3 3652856 missense probably benign 0.42
R3843:Hnf4g UTSW 3 3651302 missense probably benign 0.09
R4200:Hnf4g UTSW 3 3651284 missense possibly damaging 0.94
R4248:Hnf4g UTSW 3 3652849 missense possibly damaging 0.69
R4418:Hnf4g UTSW 3 3648094 missense possibly damaging 0.66
R4756:Hnf4g UTSW 3 3643009 missense possibly damaging 0.69
R4871:Hnf4g UTSW 3 3651388 missense possibly damaging 0.94
R5022:Hnf4g UTSW 3 3644587 missense probably damaging 0.99
R5023:Hnf4g UTSW 3 3644587 missense probably damaging 0.99
R5088:Hnf4g UTSW 3 3657121 missense probably benign 0.09
R5604:Hnf4g UTSW 3 3657126 nonsense probably null
R6746:Hnf4g UTSW 3 3657110 nonsense probably null
R7088:Hnf4g UTSW 3 3648125 splice site probably null
R7335:Hnf4g UTSW 3 3652864 missense possibly damaging 0.93
R8153:Hnf4g UTSW 3 3634190 start gained probably benign
R8182:Hnf4g UTSW 3 3651619 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ATGGATTTCAAAGTGGTTCAAGAGG -3'
(R):5'- TTTCCCTCAGTATTGGAGCAGATG -3'

Sequencing Primer
(F):5'- TTTGAAAGACTCTATCTGAACATCTG -3'
(R):5'- TTGCAATGAAACAGAACAACATG -3'
Posted On2021-06-16