Incidental Mutation 'R8676:Adipor2'
ID 673239
Institutional Source Beutler Lab
Gene Symbol Adipor2
Ensembl Gene ENSMUSG00000030168
Gene Name adiponectin receptor 2
Synonyms D6Ucla1e, 1110001I14Rik
MMRRC Submission 068531-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.165) question?
Stock # R8676 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 119330111-119394489 bp(-) (GRCm39)
Type of Mutation critical splice donor site
DNA Base Change (assembly) G to T at 119340447 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032272] [ENSMUST00000169744] [ENSMUST00000187699]
AlphaFold Q8BQS5
Predicted Effect probably benign
Transcript: ENSMUST00000032272
SMART Domains Protein: ENSMUSP00000032272
Gene: ENSMUSG00000030168

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
Blast:RING 81 138 3e-26 BLAST
Pfam:HlyIII 140 363 6.9e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169744
SMART Domains Protein: ENSMUSP00000126138
Gene: ENSMUSG00000030168

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
Blast:RING 81 138 3e-26 BLAST
Pfam:HlyIII 140 363 6.9e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187699
SMART Domains Protein: ENSMUSP00000139703
Gene: ENSMUSG00000030168

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (54/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The adiponectin receptors, ADIPOR1 (MIM 607945) and ADIPOR2, serve as receptors for globular and full-length adiponectin (MIM 605441) and mediate increased AMPK (see MIM 602739) and PPAR-alpha (PPARA; MIM 170998) ligand activities, as well as fatty acid oxidation and glucose uptake by adiponectin (Yamauchi et al., 2003 [PubMed 12802337]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display small testes and epididymis, degeneration of the seminiferous tubules, abnormal sperm maturation and abnormal thermogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm4 G A 4: 144,396,683 (GRCm39) R350C possibly damaging Het
Acsm3 T A 7: 119,374,392 (GRCm39) S281R probably damaging Het
Alk T C 17: 72,204,936 (GRCm39) S1079G probably damaging Het
Ankrd27 T C 7: 35,302,009 (GRCm39) probably null Het
Anxa6 C A 11: 54,892,108 (GRCm39) E283* probably null Het
Bnc2 T C 4: 84,194,550 (GRCm39) H858R possibly damaging Het
Btnl6 T C 17: 34,727,043 (GRCm39) S496G probably benign Het
Ccdc88a T C 11: 29,410,860 (GRCm39) S449P probably benign Het
Cdh23 A T 10: 60,246,689 (GRCm39) D916E probably damaging Het
Cfap43 A T 19: 47,736,456 (GRCm39) L1345H possibly damaging Het
Cyld A T 8: 89,456,138 (GRCm39) H396L probably benign Het
Cyp20a1 A G 1: 60,418,579 (GRCm39) T340A possibly damaging Het
Czib A G 4: 107,752,796 (GRCm39) N152D unknown Het
Dera A T 6: 137,807,202 (GRCm39) I217F probably damaging Het
Dnah11 A G 12: 118,154,539 (GRCm39) L247P probably damaging Het
Eftud2 G A 11: 102,759,447 (GRCm39) T152M probably damaging Het
Entrep1 T C 19: 23,965,858 (GRCm39) K214E probably damaging Het
Epb41l2 C T 10: 25,319,674 (GRCm39) T169M probably benign Het
Fam186a T C 15: 99,845,023 (GRCm39) D407G unknown Het
Gli3 T A 13: 15,889,619 (GRCm39) C578S probably damaging Het
Gm6408 A G 5: 146,419,237 (GRCm39) N84S probably benign Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,934,702 (GRCm39) probably benign Het
Herc2 C A 7: 55,838,361 (GRCm39) T3296K probably damaging Het
Hnf4g A T 3: 3,708,133 (GRCm39) probably benign Het
Hyal4 C A 6: 24,755,826 (GRCm39) Q15K probably damaging Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kcna3 A G 3: 106,943,908 (GRCm39) E57G probably damaging Het
Kcnc3 C A 7: 44,241,020 (GRCm39) D237E probably benign Het
Map3k8 A G 18: 4,343,137 (GRCm39) V130A probably benign Het
Mpp7 A G 18: 7,440,430 (GRCm39) probably null Het
Mtres1 A G 10: 43,408,933 (GRCm39) L70S probably benign Het
Myh13 T A 11: 67,233,311 (GRCm39) L610Q probably damaging Het
Or13p5 C A 4: 118,592,235 (GRCm39) P170T probably damaging Het
Or5ap2 T A 2: 85,680,246 (GRCm39) M150K probably benign Het
Or8b52 T C 9: 38,577,064 (GRCm39) I25M probably benign Het
Pcdhb5 A T 18: 37,454,129 (GRCm39) T170S probably benign Het
Polr3b T A 10: 84,516,251 (GRCm39) H626Q probably benign Het
Prkg1 A T 19: 31,742,146 (GRCm39) L26Q probably damaging Het
Prob1 T C 18: 35,787,039 (GRCm39) N405S possibly damaging Het
Proz T G 8: 13,123,630 (GRCm39) S300R probably damaging Het
Psg19 A G 7: 18,527,990 (GRCm39) I251T probably benign Het
Rcbtb1 T C 14: 59,467,401 (GRCm39) I413T possibly damaging Het
Rnf144b T A 13: 47,382,452 (GRCm39) Y103N probably damaging Het
Rspry1 G C 8: 95,358,747 (GRCm39) G194R probably benign Het
Scn2b A G 9: 45,036,917 (GRCm39) I142V probably damaging Het
Spata20 A T 11: 94,372,607 (GRCm39) L588H probably damaging Het
Stk32b T A 5: 37,614,503 (GRCm39) H335L probably benign Het
Taar4 A C 10: 23,836,801 (GRCm39) D137A possibly damaging Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,354,015 (GRCm39) probably benign Het
Tek A T 4: 94,738,074 (GRCm39) H708L probably benign Het
Tmem89 C T 9: 108,744,095 (GRCm39) L132F unknown Het
Ugt2b38 T C 5: 87,559,681 (GRCm39) I404V probably benign Het
Vmn1r16 C T 6: 57,299,814 (GRCm39) M269I probably benign Het
Vmn1r201 A G 13: 22,659,422 (GRCm39) K212R probably damaging Het
Vmn2r11 A C 5: 109,201,626 (GRCm39) F293V probably damaging Het
Zdhhc17 A T 10: 110,798,240 (GRCm39) probably benign Het
Zfp423 C A 8: 88,509,338 (GRCm39) M335I probably benign Het
Zfp74 T C 7: 29,634,079 (GRCm39) Y543C probably damaging Het
Zfp975 A T 7: 42,312,264 (GRCm39) S116R probably benign Het
Other mutations in Adipor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Adipor2 APN 6 119,347,129 (GRCm39) nonsense probably null
IGL01665:Adipor2 APN 6 119,338,887 (GRCm39) missense probably benign 0.06
IGL01932:Adipor2 APN 6 119,338,825 (GRCm39) missense probably damaging 1.00
IGL02111:Adipor2 APN 6 119,347,157 (GRCm39) nonsense probably null
IGL02540:Adipor2 APN 6 119,336,456 (GRCm39) missense probably benign 0.27
R0764:Adipor2 UTSW 6 119,334,215 (GRCm39) missense probably benign 0.00
R1464:Adipor2 UTSW 6 119,338,804 (GRCm39) missense probably damaging 1.00
R1464:Adipor2 UTSW 6 119,338,804 (GRCm39) missense probably damaging 1.00
R4773:Adipor2 UTSW 6 119,336,047 (GRCm39) missense probably benign 0.04
R5276:Adipor2 UTSW 6 119,334,182 (GRCm39) missense probably damaging 0.98
R5791:Adipor2 UTSW 6 119,338,866 (GRCm39) missense possibly damaging 0.91
R6765:Adipor2 UTSW 6 119,334,203 (GRCm39) missense possibly damaging 0.51
R7269:Adipor2 UTSW 6 119,347,205 (GRCm39) missense probably benign
R7477:Adipor2 UTSW 6 119,338,883 (GRCm39) missense probably benign 0.33
R9433:Adipor2 UTSW 6 119,336,486 (GRCm39) missense probably damaging 1.00
Z1177:Adipor2 UTSW 6 119,334,283 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACAGGTGCAACCCTACCTATT -3'
(R):5'- ATCTTGAGAGGGAAGTGGCT -3'

Sequencing Primer
(F):5'- CCTACCTATTAAAACAGTCTCATGTC -3'
(R):5'- CTTAAGCAGTATAGTGAGACCCTGTG -3'
Posted On 2021-06-16