Incidental Mutation 'R8676:Zdhhc17'
ID 673240
Institutional Source Beutler Lab
Gene Symbol Zdhhc17
Ensembl Gene ENSMUSG00000035798
Gene Name zinc finger, DHHC domain containing 17
Synonyms Hip14, A230053P19Rik, D130071N24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8676 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 110941780-111010140 bp(-) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) A to T at 110962379 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000041723]
AlphaFold Q80TN5
Predicted Effect probably benign
Transcript: ENSMUST00000041723
SMART Domains Protein: ENSMUSP00000043279
Gene: ENSMUSG00000035798

DomainStartEndE-ValueType
Blast:ANK 57 85 2e-8 BLAST
ANK 89 118 6.71e-2 SMART
ANK 123 152 1.99e-4 SMART
ANK 156 185 1.61e-4 SMART
ANK 189 219 1.9e-1 SMART
ANK 224 253 1.53e-5 SMART
Blast:ANK 257 286 2e-11 BLAST
transmembrane domain 305 323 N/A INTRINSIC
transmembrane domain 328 350 N/A INTRINSIC
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 384 403 N/A INTRINSIC
Pfam:zf-DHHC 434 570 1e-36 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000220247
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (54/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reminiscent of Huntington disease (decreased body weight, impaired coordination, hyperactivity, increased rearing, decreased prepulse inhibition, increased stereotypic behavior, reduced striatum, and decreased brain weight). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik A G 4: 107,895,599 N152D unknown Het
1700021F05Rik A G 10: 43,532,937 L70S probably benign Het
Acsm3 T A 7: 119,775,169 S281R probably damaging Het
Adipor2 G T 6: 119,363,486 probably benign Het
Alk T C 17: 71,897,941 S1079G probably damaging Het
Ankrd27 T C 7: 35,602,584 probably null Het
Anxa6 C A 11: 55,001,282 E283* probably null Het
Bnc2 T C 4: 84,276,313 H858R possibly damaging Het
Btnl6 T C 17: 34,508,069 S496G probably benign Het
Ccdc88a T C 11: 29,460,860 S449P probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cfap43 A T 19: 47,748,017 L1345H possibly damaging Het
Cyld A T 8: 88,729,510 H396L probably benign Het
Cyp20a1 A G 1: 60,379,420 T340A possibly damaging Het
Dera A T 6: 137,830,204 I217F probably damaging Het
Dnah11 A G 12: 118,190,804 L247P probably damaging Het
Eftud2 G A 11: 102,868,621 T152M probably damaging Het
Epb41l2 C T 10: 25,443,776 T169M probably benign Het
Fam186a T C 15: 99,947,142 D407G unknown Het
Fam189a2 T C 19: 23,988,494 K214E probably damaging Het
Gli3 T A 13: 15,715,034 C578S probably damaging Het
Gm436 G A 4: 144,670,113 R350C possibly damaging Het
Gm6408 A G 5: 146,482,427 N84S probably benign Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Herc2 C A 7: 56,188,613 T3296K probably damaging Het
Hnf4g A T 3: 3,643,073 probably benign Het
Hyal4 C A 6: 24,755,827 Q15K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcna3 A G 3: 107,036,592 E57G probably damaging Het
Kcnc3 C A 7: 44,591,596 D237E probably benign Het
Map3k8 A G 18: 4,343,137 V130A probably benign Het
Mpp7 A G 18: 7,440,430 probably null Het
Myh13 T A 11: 67,342,485 L610Q probably damaging Het
Olfr1020 T A 2: 85,849,902 M150K probably benign Het
Olfr1339 C A 4: 118,735,038 P170T probably damaging Het
Olfr917 T C 9: 38,665,768 I25M probably benign Het
Pcdhb5 A T 18: 37,321,076 T170S probably benign Het
Polr3b T A 10: 84,680,387 H626Q probably benign Het
Prkg1 A T 19: 31,764,746 L26Q probably damaging Het
Prob1 T C 18: 35,653,986 N405S possibly damaging Het
Proz T G 8: 13,073,630 S300R probably damaging Het
Psg19 A G 7: 18,794,065 I251T probably benign Het
Rcbtb1 T C 14: 59,229,952 I413T possibly damaging Het
Rnf144b T A 13: 47,228,976 Y103N probably damaging Het
Rspry1 G C 8: 94,632,119 G194R probably benign Het
Scn2b A G 9: 45,125,619 I142V probably damaging Het
Spata20 A T 11: 94,481,781 L588H probably damaging Het
Stk32b T A 5: 37,457,159 H335L probably benign Het
Taar4 A C 10: 23,960,903 D137A possibly damaging Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tek A T 4: 94,849,837 H708L probably benign Het
Tmem89 C T 9: 108,915,027 L132F unknown Het
Ugt2b38 T C 5: 87,411,822 I404V probably benign Het
Vmn1r16 C T 6: 57,322,829 M269I probably benign Het
Vmn1r201 A G 13: 22,475,252 K212R probably damaging Het
Vmn2r11 A C 5: 109,053,760 F293V probably damaging Het
Zfp423 C A 8: 87,782,710 M335I probably benign Het
Zfp74 T C 7: 29,934,654 Y543C probably damaging Het
Zfp975 A T 7: 42,662,840 S116R probably benign Het
Other mutations in Zdhhc17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Zdhhc17 APN 10 110946193 missense probably damaging 1.00
IGL01812:Zdhhc17 APN 10 110948217 missense possibly damaging 0.93
IGL01948:Zdhhc17 APN 10 110946276 missense possibly damaging 0.56
IGL02002:Zdhhc17 APN 10 110967689 missense probably benign
IGL03263:Zdhhc17 APN 10 110961016 missense probably damaging 1.00
R0153:Zdhhc17 UTSW 10 110955094 nonsense probably null
R0375:Zdhhc17 UTSW 10 110982106 nonsense probably null
R0436:Zdhhc17 UTSW 10 110981990 splice site probably null
R1452:Zdhhc17 UTSW 10 110955075 missense probably benign 0.04
R1496:Zdhhc17 UTSW 10 110946210 missense probably damaging 0.99
R1528:Zdhhc17 UTSW 10 110948189 critical splice donor site probably null
R1856:Zdhhc17 UTSW 10 110947293 splice site probably null
R2119:Zdhhc17 UTSW 10 110982048 missense possibly damaging 0.92
R3747:Zdhhc17 UTSW 10 110944420 missense probably benign 0.24
R4900:Zdhhc17 UTSW 10 110985958 missense possibly damaging 0.95
R5647:Zdhhc17 UTSW 10 110973833 missense probably damaging 1.00
R5758:Zdhhc17 UTSW 10 110944395 makesense probably null
R6228:Zdhhc17 UTSW 10 110956355 missense probably benign 0.01
R6823:Zdhhc17 UTSW 10 110955111 missense possibly damaging 0.91
R7172:Zdhhc17 UTSW 10 111009948 missense possibly damaging 0.82
R7874:Zdhhc17 UTSW 10 110982117 missense possibly damaging 0.93
R8353:Zdhhc17 UTSW 10 111009942 missense probably benign 0.09
R8674:Zdhhc17 UTSW 10 110949679 missense probably benign 0.25
R8810:Zdhhc17 UTSW 10 110948260 missense possibly damaging 0.85
R9014:Zdhhc17 UTSW 10 110949683 missense probably benign 0.22
R9028:Zdhhc17 UTSW 10 110961073 missense probably damaging 0.97
R9147:Zdhhc17 UTSW 10 110949642 missense possibly damaging 0.83
R9148:Zdhhc17 UTSW 10 110949642 missense possibly damaging 0.83
R9160:Zdhhc17 UTSW 10 110947328 missense probably damaging 0.98
R9186:Zdhhc17 UTSW 10 110944420 missense probably benign 0.24
R9360:Zdhhc17 UTSW 10 110947304 missense probably benign 0.00
Z1088:Zdhhc17 UTSW 10 110945466 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACAAGGACTGGGCTAATCTAGG -3'
(R):5'- TGGCTGTGACATGGAGTAAG -3'

Sequencing Primer
(F):5'- TCTAGGCAAGCCTTCAGCAATAGG -3'
(R):5'- GGAGTAAGCAATATAGACTTGATTCC -3'
Posted On 2021-06-16