Incidental Mutation 'R8722:Csmd2'
ID 673251
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene Name CUB and Sushi multiple domains 2
Synonyms
MMRRC Submission 068572-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.111) question?
Stock # R8722 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 127881650-128461449 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to A at 128445743 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000184063]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000184063
Predicted Effect probably benign
Transcript: ENSMUST00000221199
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.8%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik A G 2: 103,823,101 (GRCm39) C61R probably benign Het
4933427D14Rik A G 11: 72,080,422 (GRCm39) F415L probably benign Het
Abcc2 G A 19: 43,825,052 (GRCm39) G1446D possibly damaging Het
Acaca A T 11: 84,229,283 (GRCm39) E1703D possibly damaging Het
Acap3 T C 4: 155,990,415 (GRCm39) *834Q probably null Het
Adam22 A G 5: 8,166,554 (GRCm39) S726P probably benign Het
Adamtsl3 T C 7: 82,244,745 (GRCm39) probably null Het
Adgrg6 T A 10: 14,296,188 (GRCm39) I1071F probably benign Het
Agxt2 A T 15: 10,373,825 (GRCm39) D77V probably benign Het
Ahnak C A 19: 8,990,710 (GRCm39) S3998* probably null Het
Asns T A 6: 7,676,085 (GRCm39) I462F probably damaging Het
Barx2 G C 9: 31,824,280 (GRCm39) C36W probably damaging Het
Bnc2 A G 4: 84,211,883 (GRCm39) V162A possibly damaging Het
Bptf A G 11: 107,022,295 (GRCm39) S152P unknown Het
Brpf3 T C 17: 29,029,510 (GRCm39) L490P probably benign Het
Carmil1 T C 13: 24,220,568 (GRCm39) D1052G probably benign Het
Ccn1 T A 3: 145,354,584 (GRCm39) N109I probably damaging Het
Cdk17 A G 10: 93,064,565 (GRCm39) H311R probably damaging Het
Cenpj G A 14: 56,772,975 (GRCm39) R1022C probably damaging Het
Cog5 A G 12: 31,969,703 (GRCm39) D741G possibly damaging Het
Dnah17 G A 11: 117,961,283 (GRCm39) Q2568* probably null Het
Dspp A G 5: 104,326,433 (GRCm39) D932G unknown Het
Dtwd2 T C 18: 49,833,385 (GRCm39) T223A probably damaging Het
Fzd8 A G 18: 9,213,686 (GRCm39) N256S possibly damaging Het
Gm10800 AAGAAAACTGAAAATCAT A 2: 98,497,379 (GRCm39) probably benign Het
Gm9936 T C 5: 114,995,515 (GRCm39) Y34C unknown Het
Gstcd T A 3: 132,777,822 (GRCm39) K330* probably null Het
Igf2bp1 A G 11: 95,861,606 (GRCm39) V277A possibly damaging Het
Kidins220 G A 12: 25,051,593 (GRCm39) V332I probably benign Het
Kif24 T C 4: 41,394,233 (GRCm39) H1014R probably benign Het
Lrrc43 T C 5: 123,646,142 (GRCm39) Y639H possibly damaging Het
Med22 T C 2: 26,800,313 (GRCm39) T39A probably benign Het
Morn3 T C 5: 123,179,177 (GRCm39) Y91C probably damaging Het
Myo1a T C 10: 127,542,707 (GRCm39) M115T probably damaging Het
Or10w3 T C 19: 13,704,033 (GRCm39) M136T possibly damaging Het
Or1e32 T A 11: 73,705,882 (GRCm39) I9F probably benign Het
Or52n2b C T 7: 104,565,708 (GRCm39) R265H probably benign Het
Pdcl T C 2: 37,247,317 (GRCm39) D24G probably benign Het
Pde10a G A 17: 9,163,772 (GRCm39) C250Y probably benign Het
Pla2g10 A T 16: 13,548,254 (GRCm39) L8M unknown Het
Plch2 A T 4: 155,069,860 (GRCm39) probably benign Het
Ppp1r42 T C 1: 10,055,894 (GRCm39) K198R probably benign Het
Prlh G T 1: 90,880,897 (GRCm39) R23L possibly damaging Het
Ranbp2 C A 10: 58,312,049 (GRCm39) T923K probably damaging Het
Rps11 T C 7: 44,772,616 (GRCm39) N65S probably benign Het
Ryr3 T C 2: 112,603,116 (GRCm39) T2463A probably benign Het
Shank2 C T 7: 143,729,485 (GRCm39) probably benign Het
Slc12a1 T A 2: 125,002,518 (GRCm39) V166E probably damaging Het
Slc6a9 C T 4: 117,714,452 (GRCm39) R97C unknown Het
Slpi A C 2: 164,197,975 (GRCm39) M1R probably null Het
Syne2 T A 12: 75,972,095 (GRCm39) V994D probably benign Het
Tacc3 T C 5: 33,825,553 (GRCm39) Y435H probably damaging Het
Tpgs2 T A 18: 25,274,679 (GRCm39) Q132L probably benign Het
Usp13 T A 3: 32,956,114 (GRCm39) I462N probably benign Het
Zfp281 C T 1: 136,553,334 (GRCm39) A104V probably benign Het
Zfp40 A G 17: 23,395,157 (GRCm39) C477R probably damaging Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128,377,266 (GRCm39) missense probably benign 0.03
IGL01098:Csmd2 APN 4 127,952,845 (GRCm39) missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128,262,923 (GRCm39) missense probably benign 0.04
IGL01364:Csmd2 APN 4 128,308,081 (GRCm39) missense probably benign 0.01
IGL01530:Csmd2 APN 4 128,308,094 (GRCm39) missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128,457,098 (GRCm39) nonsense probably null
IGL01670:Csmd2 APN 4 128,407,164 (GRCm39) splice site probably benign
IGL01707:Csmd2 APN 4 128,276,798 (GRCm39) missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128,374,638 (GRCm39) splice site probably benign
IGL01837:Csmd2 APN 4 128,313,363 (GRCm39) missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128,453,740 (GRCm39) missense unknown
IGL02013:Csmd2 APN 4 128,215,116 (GRCm39) missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128,453,672 (GRCm39) missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128,371,263 (GRCm39) splice site probably benign
IGL02303:Csmd2 APN 4 128,262,801 (GRCm39) missense probably benign 0.01
IGL02317:Csmd2 APN 4 128,357,520 (GRCm39) splice site probably benign
IGL02322:Csmd2 APN 4 128,357,520 (GRCm39) splice site probably benign
IGL02338:Csmd2 APN 4 128,288,859 (GRCm39) missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128,407,165 (GRCm39) splice site probably benign
IGL02428:Csmd2 APN 4 128,368,609 (GRCm39) missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128,428,050 (GRCm39) missense probably benign
IGL02701:Csmd2 APN 4 128,389,934 (GRCm39) missense probably benign 0.17
IGL02801:Csmd2 APN 4 128,445,868 (GRCm39) splice site probably null
IGL02818:Csmd2 APN 4 128,103,521 (GRCm39) missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128,415,677 (GRCm39) missense probably benign 0.00
IGL02876:Csmd2 APN 4 128,215,128 (GRCm39) nonsense probably null
IGL02977:Csmd2 APN 4 128,387,069 (GRCm39) nonsense probably null
IGL03006:Csmd2 APN 4 128,374,558 (GRCm39) splice site probably benign
IGL03032:Csmd2 APN 4 128,412,834 (GRCm39) missense probably benign 0.03
IGL03148:Csmd2 APN 4 128,278,062 (GRCm39) missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128,308,092 (GRCm39) nonsense probably null
IGL03245:Csmd2 APN 4 128,402,915 (GRCm39) missense probably benign 0.12
IGL03376:Csmd2 APN 4 128,411,464 (GRCm39) missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128,190,222 (GRCm39) missense probably benign 0.01
R0109:Csmd2 UTSW 4 128,438,536 (GRCm39) missense probably benign 0.03
R0112:Csmd2 UTSW 4 128,389,822 (GRCm39) missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128,415,704 (GRCm39) missense probably benign 0.02
R0390:Csmd2 UTSW 4 128,027,466 (GRCm39) intron probably benign
R0441:Csmd2 UTSW 4 128,414,023 (GRCm39) missense probably benign 0.00
R0519:Csmd2 UTSW 4 128,380,798 (GRCm39) missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128,007,469 (GRCm39) missense probably benign 0.00
R0746:Csmd2 UTSW 4 128,308,090 (GRCm39) missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128,389,981 (GRCm39) missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128,415,807 (GRCm39) missense probably benign 0.00
R1476:Csmd2 UTSW 4 128,380,794 (GRCm39) missense probably benign 0.08
R1641:Csmd2 UTSW 4 128,377,188 (GRCm39) missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128,389,988 (GRCm39) missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128,308,185 (GRCm39) critical splice donor site probably null
R2870:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2870:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2871:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2871:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2872:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2872:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2873:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2893:Csmd2 UTSW 4 128,432,786 (GRCm39) splice site probably null
R3796:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3797:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3798:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3914:Csmd2 UTSW 4 128,215,117 (GRCm39) missense probably benign 0.07
R4198:Csmd2 UTSW 4 128,404,717 (GRCm39) missense probably benign 0.07
R4489:Csmd2 UTSW 4 128,275,738 (GRCm39) missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128,373,888 (GRCm39) splice site probably null
R4581:Csmd2 UTSW 4 128,262,881 (GRCm39) missense probably benign 0.02
R4599:Csmd2 UTSW 4 127,881,921 (GRCm39) missense probably benign 0.35
R4649:Csmd2 UTSW 4 128,439,866 (GRCm39) missense probably benign
R4706:Csmd2 UTSW 4 128,438,544 (GRCm39) missense probably benign
R4776:Csmd2 UTSW 4 128,336,685 (GRCm39) missense probably benign 0.09
R4838:Csmd2 UTSW 4 128,411,542 (GRCm39) missense probably benign
R4900:Csmd2 UTSW 4 128,346,318 (GRCm39) missense probably benign 0.03
R4999:Csmd2 UTSW 4 128,415,723 (GRCm39) missense probably benign 0.00
R5024:Csmd2 UTSW 4 128,215,141 (GRCm39) missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 127,952,901 (GRCm39) missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128,445,828 (GRCm39) missense probably benign 0.27
R5172:Csmd2 UTSW 4 128,371,190 (GRCm39) missense probably benign 0.10
R5231:Csmd2 UTSW 4 128,439,842 (GRCm39) missense probably benign 0.00
R5279:Csmd2 UTSW 4 128,350,707 (GRCm39) missense probably benign 0.30
R5287:Csmd2 UTSW 4 128,380,677 (GRCm39) missense probably benign 0.01
R5403:Csmd2 UTSW 4 128,380,677 (GRCm39) missense probably benign 0.01
R5410:Csmd2 UTSW 4 128,442,612 (GRCm39) missense probably benign
R5551:Csmd2 UTSW 4 128,404,741 (GRCm39) missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128,356,682 (GRCm39) critical splice donor site probably null
R5826:Csmd2 UTSW 4 128,412,992 (GRCm39) splice site probably null
R5907:Csmd2 UTSW 4 128,091,178 (GRCm39) missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128,445,781 (GRCm39) missense probably benign 0.01
R5970:Csmd2 UTSW 4 128,439,944 (GRCm39) missense probably benign 0.00
R5977:Csmd2 UTSW 4 127,952,827 (GRCm39) missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128,453,739 (GRCm39) missense unknown
R6075:Csmd2 UTSW 4 128,380,658 (GRCm39) missense probably benign 0.15
R6129:Csmd2 UTSW 4 128,387,127 (GRCm39) missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128,294,172 (GRCm39) missense probably benign 0.00
R6366:Csmd2 UTSW 4 128,377,245 (GRCm39) missense probably benign 0.00
R6404:Csmd2 UTSW 4 128,415,743 (GRCm39) missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127,881,893 (GRCm39) missense probably benign 0.24
R6441:Csmd2 UTSW 4 128,288,757 (GRCm39) missense probably benign 0.03
R6643:Csmd2 UTSW 4 128,266,390 (GRCm39) missense probably benign 0.14
R6724:Csmd2 UTSW 4 128,457,164 (GRCm39) missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128,357,606 (GRCm39) missense probably benign 0.00
R6750:Csmd2 UTSW 4 128,091,018 (GRCm39) missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128,277,743 (GRCm39) missense probably benign 0.11
R6842:Csmd2 UTSW 4 128,402,952 (GRCm39) missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128,357,587 (GRCm39) missense probably benign 0.27
R6868:Csmd2 UTSW 4 128,336,633 (GRCm39) missense probably benign
R6882:Csmd2 UTSW 4 128,343,062 (GRCm39) missense probably benign 0.01
R7019:Csmd2 UTSW 4 128,262,856 (GRCm39) missense
R7028:Csmd2 UTSW 4 128,171,021 (GRCm39) missense
R7096:Csmd2 UTSW 4 128,356,519 (GRCm39) missense
R7122:Csmd2 UTSW 4 128,343,020 (GRCm39) missense
R7125:Csmd2 UTSW 4 128,389,955 (GRCm39) missense
R7197:Csmd2 UTSW 4 128,404,826 (GRCm39) missense
R7234:Csmd2 UTSW 4 128,350,572 (GRCm39) missense
R7299:Csmd2 UTSW 4 128,422,055 (GRCm39) missense
R7301:Csmd2 UTSW 4 128,422,055 (GRCm39) missense
R7319:Csmd2 UTSW 4 128,287,472 (GRCm39) missense
R7331:Csmd2 UTSW 4 128,458,021 (GRCm39) splice site probably null
R7332:Csmd2 UTSW 4 128,313,360 (GRCm39) missense
R7352:Csmd2 UTSW 4 128,451,429 (GRCm39) missense
R7402:Csmd2 UTSW 4 128,215,889 (GRCm39) missense
R7402:Csmd2 UTSW 4 128,215,888 (GRCm39) missense
R7474:Csmd2 UTSW 4 128,439,920 (GRCm39) missense
R7555:Csmd2 UTSW 4 128,346,251 (GRCm39) missense
R7592:Csmd2 UTSW 4 128,357,591 (GRCm39) missense
R7700:Csmd2 UTSW 4 128,439,549 (GRCm39) splice site probably null
R7714:Csmd2 UTSW 4 128,276,743 (GRCm39) nonsense probably null
R7734:Csmd2 UTSW 4 128,445,850 (GRCm39) missense
R7735:Csmd2 UTSW 4 128,350,723 (GRCm39) critical splice donor site probably null
R7757:Csmd2 UTSW 4 128,377,249 (GRCm39) missense
R7805:Csmd2 UTSW 4 128,313,366 (GRCm39) missense
R7823:Csmd2 UTSW 4 128,103,698 (GRCm39) missense
R7904:Csmd2 UTSW 4 128,313,346 (GRCm39) missense
R7946:Csmd2 UTSW 4 128,414,058 (GRCm39) missense
R7964:Csmd2 UTSW 4 128,417,303 (GRCm39) missense
R7968:Csmd2 UTSW 4 128,091,118 (GRCm39) missense
R8003:Csmd2 UTSW 4 128,432,980 (GRCm39) nonsense probably null
R8071:Csmd2 UTSW 4 128,287,331 (GRCm39) missense
R8504:Csmd2 UTSW 4 128,440,483 (GRCm39) missense
R8511:Csmd2 UTSW 4 128,262,692 (GRCm39) missense
R8517:Csmd2 UTSW 4 128,446,479 (GRCm39) missense
R8704:Csmd2 UTSW 4 128,091,147 (GRCm39) missense
R8729:Csmd2 UTSW 4 128,356,638 (GRCm39) missense
R8801:Csmd2 UTSW 4 128,457,195 (GRCm39) missense probably damaging 0.97
R8803:Csmd2 UTSW 4 128,440,477 (GRCm39) missense
R8839:Csmd2 UTSW 4 128,336,681 (GRCm39) missense
R8867:Csmd2 UTSW 4 128,451,469 (GRCm39) missense
R8913:Csmd2 UTSW 4 128,417,351 (GRCm39) missense
R8928:Csmd2 UTSW 4 128,369,582 (GRCm39) missense
R8974:Csmd2 UTSW 4 128,446,380 (GRCm39) missense
R9001:Csmd2 UTSW 4 128,308,079 (GRCm39) missense
R9132:Csmd2 UTSW 4 128,443,007 (GRCm39) missense
R9245:Csmd2 UTSW 4 128,200,168 (GRCm39) missense
R9249:Csmd2 UTSW 4 128,313,323 (GRCm39) nonsense probably null
R9254:Csmd2 UTSW 4 128,091,112 (GRCm39) missense
R9265:Csmd2 UTSW 4 128,294,163 (GRCm39) missense
R9407:Csmd2 UTSW 4 128,442,613 (GRCm39) missense
R9432:Csmd2 UTSW 4 128,171,004 (GRCm39) missense
R9559:Csmd2 UTSW 4 128,438,561 (GRCm39) missense
R9673:Csmd2 UTSW 4 128,308,062 (GRCm39) missense
R9735:Csmd2 UTSW 4 128,402,901 (GRCm39) missense
R9749:Csmd2 UTSW 4 128,389,921 (GRCm39) missense
R9803:Csmd2 UTSW 4 128,262,986 (GRCm39) missense
Z1177:Csmd2 UTSW 4 128,424,590 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TCACCCTAGCAGTGTGACATG -3'
(R):5'- AACACTGGTCCTGATGGGAG -3'

Sequencing Primer
(F):5'- TAGCAGTGTGACATGCCCAGTG -3'
(R):5'- GTCCTGATGGGAGCACATC -3'
Posted On 2021-07-14