Incidental Mutation 'R8823:Trmo'
ID673262
Institutional Source Beutler Lab
Gene Symbol Trmo
Ensembl Gene ENSMUSG00000028331
Gene NametRNA methyltransferase O
Synonyms5830415F09Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8823 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location46376505-46389437 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46382604 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 164 (D164G)
Ref Sequence ENSEMBL: ENSMUSP00000083752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030015] [ENSMUST00000086563] [ENSMUST00000151903]
Predicted Effect probably damaging
Transcript: ENSMUST00000030015
AA Change: D164G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030015
Gene: ENSMUSG00000028331
AA Change: D164G

DomainStartEndE-ValueType
Pfam:UPF0066 42 165 2.3e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086563
AA Change: D164G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083752
Gene: ENSMUSG00000028331
AA Change: D164G

DomainStartEndE-ValueType
Pfam:UPF0066 44 164 1.2e-46 PFAM
low complexity region 431 442 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151903
AA Change: D171G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119785
Gene: ENSMUSG00000028331
AA Change: D171G

DomainStartEndE-ValueType
Pfam:UPF0066 49 172 4.1e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 T A 8: 40,680,189 I232K probably benign Het
Ap5z1 T C 5: 142,474,436 L506P probably benign Het
Ceacam20 A T 7: 19,971,504 Y140F probably damaging Het
Chfr G A 5: 110,152,392 R334H probably damaging Het
Emx2 A G 19: 59,459,448 H78R probably damaging Het
Etnppl G A 3: 130,626,546 G204R probably damaging Het
Fah A G 7: 84,605,717 F3L possibly damaging Het
Galnt12 G T 4: 47,091,928 probably benign Het
Gbx1 A G 5: 24,505,053 S265P probably damaging Het
Gm17087 A G 17: 8,566,401 *157R probably null Het
Gm5426 A T 10: 96,136,771 I57F possibly damaging Het
Grin2a T A 16: 9,669,894 N380I possibly damaging Het
Grip1 C T 10: 119,975,951 T269I Het
Hace1 T C 10: 45,648,860 Y241H probably damaging Het
Hrc A G 7: 45,336,298 D291G possibly damaging Het
Ifi208 A G 1: 173,683,536 Y419C probably damaging Het
Ighv8-5 A G 12: 115,067,647 S91P probably damaging Het
Igkv15-103 T C 6: 68,437,871 L98P probably damaging Het
Igsf5 C T 16: 96,421,739 S61L possibly damaging Het
Ipo9 A G 1: 135,419,339 W138R probably damaging Het
Kank4 A T 4: 98,780,003 L69Q probably damaging Het
Kcnd3 T C 3: 105,667,014 I505T probably benign Het
Lrtm2 T A 6: 119,317,232 I313F probably damaging Het
Mug2 A T 6: 122,063,689 I733F possibly damaging Het
Myh2 A T 11: 67,185,474 R800S probably damaging Het
Myo1d A T 11: 80,601,745 I728N possibly damaging Het
Olfr519 A G 7: 108,893,948 I158T probably benign Het
Pdcd1 T C 1: 94,041,495 R33G probably benign Het
Polr1b T C 2: 129,125,537 F950S probably damaging Het
Prpf8 T A 11: 75,493,456 M697K probably benign Het
Psmc2 T A 5: 21,800,576 D218E probably damaging Het
Ptpn12 A G 5: 20,998,623 Y386H probably damaging Het
Rilpl2 C T 5: 124,468,653 R166K possibly damaging Het
Rtn4 T A 11: 29,706,609 N254K probably benign Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc35b2 T A 17: 45,566,968 H291Q probably damaging Het
Slc38a3 A C 9: 107,655,951 Y308D probably damaging Het
Snrpd2 T C 7: 19,152,610 V106A probably benign Het
Sybu C A 15: 44,677,602 A355S possibly damaging Het
Tes3-ps A T 13: 49,494,216 R189S probably benign Het
Vmn1r225 A G 17: 20,502,561 Q88R probably benign Het
Xkr9 T C 1: 13,672,608 V39A probably benign Het
Xpo1 A T 11: 23,267,752 M73L probably benign Het
Zbtb21 G A 16: 97,951,316 T589I probably damaging Het
Zbtb41 A G 1: 139,423,154 K2E probably damaging Het
Zfp105 A G 9: 122,930,503 K413R possibly damaging Het
Other mutations in Trmo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Trmo APN 4 46382490 missense probably benign
IGL01296:Trmo APN 4 46387589 missense probably damaging 1.00
IGL01308:Trmo APN 4 46377053 utr 3 prime probably benign
IGL01544:Trmo APN 4 46386169 missense probably damaging 1.00
IGL01545:Trmo APN 4 46386169 missense probably damaging 1.00
IGL01722:Trmo APN 4 46386092 critical splice donor site probably null
IGL02085:Trmo APN 4 46380217 missense probably damaging 1.00
IGL02927:Trmo APN 4 46387602 missense probably damaging 1.00
R0645:Trmo UTSW 4 46377083 utr 3 prime probably benign
R0745:Trmo UTSW 4 46382104 missense probably damaging 1.00
R1365:Trmo UTSW 4 46380278 missense probably damaging 1.00
R1835:Trmo UTSW 4 46380158 missense probably damaging 1.00
R3928:Trmo UTSW 4 46382647 missense probably damaging 1.00
R3929:Trmo UTSW 4 46382647 missense probably damaging 1.00
R4497:Trmo UTSW 4 46382140 missense probably damaging 1.00
R4938:Trmo UTSW 4 46382388 missense probably benign 0.00
R4980:Trmo UTSW 4 46389364 nonsense probably null
R5209:Trmo UTSW 4 46387740 missense probably damaging 0.99
R5639:Trmo UTSW 4 46382073 missense probably benign 0.00
R5855:Trmo UTSW 4 46382568 missense probably benign 0.43
R6151:Trmo UTSW 4 46389390 missense probably damaging 1.00
R7351:Trmo UTSW 4 46387716 missense possibly damaging 0.78
R8684:Trmo UTSW 4 46386251 nonsense probably null
R8684:Trmo UTSW 4 46386253 critical splice acceptor site probably null
R8856:Trmo UTSW 4 46387625 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTCTGTCTTCTGGCAAAGTGTG -3'
(R):5'- GGCTCATTGAGGTCAAGGTAGG -3'

Sequencing Primer
(F):5'- ACATGTCTCTGGACTTCTGAGAG -3'
(R):5'- TCAAGGTAGGTGTTTGAGAGAGAC -3'
Posted On2021-07-15