Incidental Mutation 'R8823:Galnt12'
ID673263
Institutional Source Beutler Lab
Gene Symbol Galnt12
Ensembl Gene ENSMUSG00000039774
Gene Namepolypeptide N-acetylgalactosaminyltransferase 12
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8823 (G1)
Quality Score98.0078
Status Not validated
Chromosome4
Chromosomal Location47091909-47123070 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to T at 47091928 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045041] [ENSMUST00000107744]
Predicted Effect probably benign
Transcript: ENSMUST00000045041
SMART Domains Protein: ENSMUSP00000045721
Gene: ENSMUSG00000039774

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
low complexity region 78 91 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 131 375 3.4e-10 PFAM
Pfam:Glycos_transf_2 134 317 1.4e-35 PFAM
Pfam:Glyco_tranf_2_2 134 360 6.6e-8 PFAM
Pfam:Glyco_transf_7C 290 363 3e-9 PFAM
RICIN 440 572 8.09e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107744
SMART Domains Protein: ENSMUSP00000103373
Gene: ENSMUSG00000039774

DomainStartEndE-ValueType
Pfam:Glyco_transf_7C 5 71 7.5e-9 PFAM
RICIN 148 280 8.09e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferases, which catalyze the transfer of N-acetylgalactosamine (GalNAc) from UDP-GalNAc to a serine or threonine residue on a polypeptide acceptor in the initial step of O-linked protein glycosylation. Mutations in this gene are associated with an increased susceptibility to colorectal cancer.[provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 T A 8: 40,680,189 I232K probably benign Het
Ap5z1 T C 5: 142,474,436 L506P probably benign Het
Ceacam20 A T 7: 19,971,504 Y140F probably damaging Het
Chfr G A 5: 110,152,392 R334H probably damaging Het
Emx2 A G 19: 59,459,448 H78R probably damaging Het
Etnppl G A 3: 130,626,546 G204R probably damaging Het
Fah A G 7: 84,605,717 F3L possibly damaging Het
Gbx1 A G 5: 24,505,053 S265P probably damaging Het
Gm17087 A G 17: 8,566,401 *157R probably null Het
Gm5426 A T 10: 96,136,771 I57F possibly damaging Het
Grin2a T A 16: 9,669,894 N380I possibly damaging Het
Grip1 C T 10: 119,975,951 T269I Het
Hace1 T C 10: 45,648,860 Y241H probably damaging Het
Hrc A G 7: 45,336,298 D291G possibly damaging Het
Ifi208 A G 1: 173,683,536 Y419C probably damaging Het
Ighv8-5 A G 12: 115,067,647 S91P probably damaging Het
Igkv15-103 T C 6: 68,437,871 L98P probably damaging Het
Igsf5 C T 16: 96,421,739 S61L possibly damaging Het
Ipo9 A G 1: 135,419,339 W138R probably damaging Het
Kank4 A T 4: 98,780,003 L69Q probably damaging Het
Kcnd3 T C 3: 105,667,014 I505T probably benign Het
Lrtm2 T A 6: 119,317,232 I313F probably damaging Het
Mug2 A T 6: 122,063,689 I733F possibly damaging Het
Myh2 A T 11: 67,185,474 R800S probably damaging Het
Myo1d A T 11: 80,601,745 I728N possibly damaging Het
Olfr519 A G 7: 108,893,948 I158T probably benign Het
Pdcd1 T C 1: 94,041,495 R33G probably benign Het
Polr1b T C 2: 129,125,537 F950S probably damaging Het
Prpf8 T A 11: 75,493,456 M697K probably benign Het
Psmc2 T A 5: 21,800,576 D218E probably damaging Het
Ptpn12 A G 5: 20,998,623 Y386H probably damaging Het
Rilpl2 C T 5: 124,468,653 R166K possibly damaging Het
Rtn4 T A 11: 29,706,609 N254K probably benign Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc35b2 T A 17: 45,566,968 H291Q probably damaging Het
Slc38a3 A C 9: 107,655,951 Y308D probably damaging Het
Snrpd2 T C 7: 19,152,610 V106A probably benign Het
Sybu C A 15: 44,677,602 A355S possibly damaging Het
Tes3-ps A T 13: 49,494,216 R189S probably benign Het
Trmo T C 4: 46,382,604 D164G probably damaging Het
Vmn1r225 A G 17: 20,502,561 Q88R probably benign Het
Xkr9 T C 1: 13,672,608 V39A probably benign Het
Xpo1 A T 11: 23,267,752 M73L probably benign Het
Zbtb21 G A 16: 97,951,316 T589I probably damaging Het
Zbtb41 A G 1: 139,423,154 K2E probably damaging Het
Zfp105 A G 9: 122,930,503 K413R possibly damaging Het
Other mutations in Galnt12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01877:Galnt12 APN 4 47112315 splice site probably benign
IGL02188:Galnt12 APN 4 47122521 missense probably damaging 1.00
IGL02217:Galnt12 APN 4 47113832 missense probably damaging 1.00
IGL02388:Galnt12 APN 4 47117941 missense probably damaging 1.00
IGL02550:Galnt12 APN 4 47104126 missense possibly damaging 0.47
IGL03062:Galnt12 APN 4 47122566 missense possibly damaging 0.80
R0508:Galnt12 UTSW 4 47104255 missense probably damaging 1.00
R1513:Galnt12 UTSW 4 47117956 missense probably damaging 1.00
R1634:Galnt12 UTSW 4 47108585 splice site probably null
R2072:Galnt12 UTSW 4 47108477 nonsense probably null
R2297:Galnt12 UTSW 4 47113834 missense probably damaging 1.00
R3113:Galnt12 UTSW 4 47108415 missense probably benign 0.01
R3157:Galnt12 UTSW 4 47104264 missense probably damaging 1.00
R3158:Galnt12 UTSW 4 47104264 missense probably damaging 1.00
R3159:Galnt12 UTSW 4 47104264 missense probably damaging 1.00
R3725:Galnt12 UTSW 4 47104140 missense probably damaging 1.00
R4284:Galnt12 UTSW 4 47104231 missense probably damaging 1.00
R4691:Galnt12 UTSW 4 47104143 missense probably damaging 1.00
R5134:Galnt12 UTSW 4 47113818 missense probably damaging 1.00
R5408:Galnt12 UTSW 4 47104169 missense probably damaging 1.00
R5657:Galnt12 UTSW 4 47104150 missense possibly damaging 0.95
R6074:Galnt12 UTSW 4 47112405 missense probably damaging 1.00
R6406:Galnt12 UTSW 4 47122534 missense probably benign 0.00
R6721:Galnt12 UTSW 4 47122529 nonsense probably null
R7287:Galnt12 UTSW 4 47108525 missense probably damaging 1.00
R7407:Galnt12 UTSW 4 47120362 missense probably damaging 1.00
R7512:Galnt12 UTSW 4 47108406 missense possibly damaging 0.83
R7810:Galnt12 UTSW 4 47113786 missense probably damaging 1.00
R8871:Galnt12 UTSW 4 47108582 critical splice donor site probably null
X0025:Galnt12 UTSW 4 47104166 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAAGGAAGGGTCCCCATAG -3'
(R):5'- TGATCTGGTGCTGCTTCACG -3'

Sequencing Primer
(F):5'- TCCCCATAGCGCCCAGAG -3'
(R):5'- GGTGCTGCTTCACGCTCTC -3'
Posted On2021-07-15