Incidental Mutation 'R8823:Fah'
ID 673278
Institutional Source Beutler Lab
Gene Symbol Fah
Ensembl Gene ENSMUSG00000030630
Gene Name fumarylacetoacetate hydrolase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8823 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 84585159-84606722 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84605717 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 3 (F3L)
Ref Sequence ENSEMBL: ENSMUSP00000032865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032865] [ENSMUST00000128460]
AlphaFold P35505
PDB Structure CRYSTAL STRUCTURE OF FUMARYLACETOACETATE HYDROLASE COMPLEXED WITH 4-(HYDROXYMETHYLPHOSPHINOYL)-3-OXO-BUTANOIC ACID [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF FUMARYLACETOACETATE HYDROLASE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF FUMARYLACETOACETATE HYDROLASE COMPLEXED WITH FUMARATE AND ACETOACETATE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE FUMARYLACETOACETATE HYDROLASE REFINED AT 1.55 ANGSTROM RESOLUTION [X-RAY DIFFRACTION]
Mouse fumarylacetoacetate hydrolase complexes with a transition-state mimic of the complete substrate [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032865
AA Change: F3L

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032865
Gene: ENSMUSG00000030630
AA Change: F3L

DomainStartEndE-ValueType
Pfam:FAA_hydrolase_N 15 118 1.7e-36 PFAM
Pfam:FAA_hydrolase 123 413 1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128460
SMART Domains Protein: ENSMUSP00000121439
Gene: ENSMUSG00000030630

DomainStartEndE-ValueType
Pfam:FAA_hydrolase_N 1 48 7.2e-10 PFAM
Pfam:FAA_hydrolase 53 140 7.3e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the last enzyme in the tyrosine catabolism pathway. FAH deficiency is associated with Type 1 hereditary tyrosinemia (HT). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted, deletion, and ENU-induced mutations die perinatally with liver and kidney dysfunction, hypoglycemia, and grossly altered liver mRNA expression. Mice homozygous for a mutation of this gene exhibit inappropriate bouts of activity during the light period of the circadian cycle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 T A 8: 40,680,189 I232K probably benign Het
Ap5z1 T C 5: 142,474,436 L506P probably benign Het
Ceacam20 A T 7: 19,971,504 Y140F probably damaging Het
Chfr G A 5: 110,152,392 R334H probably damaging Het
Emx2 A G 19: 59,459,448 H78R probably damaging Het
Etnppl G A 3: 130,626,546 G204R probably damaging Het
Galnt12 G T 4: 47,091,928 probably benign Het
Gbx1 A G 5: 24,505,053 S265P probably damaging Het
Gm17087 A G 17: 8,566,401 *157R probably null Het
Gm5426 A T 10: 96,136,771 I57F possibly damaging Het
Grin2a T A 16: 9,669,894 N380I possibly damaging Het
Grip1 C T 10: 119,975,951 T269I Het
Hace1 T C 10: 45,648,860 Y241H probably damaging Het
Hrc A G 7: 45,336,298 D291G possibly damaging Het
Ifi208 A G 1: 173,683,536 Y419C probably damaging Het
Ighv8-5 A G 12: 115,067,647 S91P probably damaging Het
Igkv15-103 T C 6: 68,437,871 L98P probably damaging Het
Igsf5 C T 16: 96,421,739 S61L possibly damaging Het
Ipo9 A G 1: 135,419,339 W138R probably damaging Het
Kank4 A T 4: 98,780,003 L69Q probably damaging Het
Kcnd3 T C 3: 105,667,014 I505T probably benign Het
Lrtm2 T A 6: 119,317,232 I313F probably damaging Het
Mug2 A T 6: 122,063,689 I733F possibly damaging Het
Myh2 A T 11: 67,185,474 R800S probably damaging Het
Myo1d A T 11: 80,601,745 I728N possibly damaging Het
Olfr519 A G 7: 108,893,948 I158T probably benign Het
Pdcd1 T C 1: 94,041,495 R33G probably benign Het
Polr1b T C 2: 129,125,537 F950S probably damaging Het
Prpf8 T A 11: 75,493,456 M697K probably benign Het
Psmc2 T A 5: 21,800,576 D218E probably damaging Het
Ptpn12 A G 5: 20,998,623 Y386H probably damaging Het
Rilpl2 C T 5: 124,468,653 R166K possibly damaging Het
Rtn4 T A 11: 29,706,609 N254K probably benign Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sesn3 T A 9: 14,310,240 probably benign Het
Slc35b2 T A 17: 45,566,968 H291Q probably damaging Het
Slc38a3 A C 9: 107,655,951 Y308D probably damaging Het
Snrpd2 T C 7: 19,152,610 V106A probably benign Het
Sybu C A 15: 44,677,602 A355S possibly damaging Het
Tes3-ps A T 13: 49,494,216 R189S probably benign Het
Trmo T C 4: 46,382,604 D164G probably damaging Het
Vmn1r225 A G 17: 20,502,561 Q88R probably benign Het
Xkr9 T C 1: 13,672,608 V39A probably benign Het
Xpo1 A T 11: 23,267,752 M73L probably benign Het
Zbtb21 G A 16: 97,951,316 T589I probably damaging Het
Zbtb41 A G 1: 139,423,154 K2E probably damaging Het
Zfp105 A G 9: 122,930,503 K413R possibly damaging Het
Other mutations in Fah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01798:Fah APN 7 84589629 missense probably benign 0.33
IGL02374:Fah APN 7 84605701 missense probably benign 0.02
IGL02975:Fah APN 7 84601079 missense probably benign 0.00
IGL03403:Fah APN 7 84593209 missense probably damaging 1.00
R0245:Fah UTSW 7 84595498 missense probably benign
R0689:Fah UTSW 7 84593184 critical splice donor site probably null
R1173:Fah UTSW 7 84601136 start codon destroyed probably null 1.00
R1413:Fah UTSW 7 84593212 missense probably damaging 0.99
R1995:Fah UTSW 7 84602181 missense probably damaging 1.00
R2150:Fah UTSW 7 84594834 missense probably damaging 1.00
R3612:Fah UTSW 7 84585290 missense probably damaging 0.98
R3620:Fah UTSW 7 84588951 splice site probably null
R4360:Fah UTSW 7 84589648 missense probably damaging 1.00
R4386:Fah UTSW 7 84599136 missense probably damaging 1.00
R4923:Fah UTSW 7 84602052 intron probably benign
R5151:Fah UTSW 7 84601051 missense possibly damaging 0.87
R5443:Fah UTSW 7 84592396 missense probably damaging 0.96
R5470:Fah UTSW 7 84593185 critical splice donor site probably null
R5976:Fah UTSW 7 84594741 missense probably benign 0.00
R6086:Fah UTSW 7 84588912 missense probably damaging 1.00
R6272:Fah UTSW 7 84595545 missense probably damaging 1.00
R6502:Fah UTSW 7 84594835 missense probably damaging 1.00
R6586:Fah UTSW 7 84593260 missense probably benign 0.04
R7522:Fah UTSW 7 84597074 missense probably benign 0.00
R7832:Fah UTSW 7 84595478 missense probably damaging 1.00
R8535:Fah UTSW 7 84601097 missense probably benign
RF002:Fah UTSW 7 84589628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTAACGTGCACAGCTATGG -3'
(R):5'- GCGGGTGCTAAAAGAATCAC -3'

Sequencing Primer
(F):5'- TGCACAGCTATGGGTCCTGAG -3'
(R):5'- TGCTAAAAGAATCACTAGGGTGG -3'
Posted On 2021-07-15