Incidental Mutation 'R8823:Vmn1r225'
ID673298
Institutional Source Beutler Lab
Gene Symbol Vmn1r225
Ensembl Gene ENSMUSG00000043537
Gene Namevomeronasal 1 receptor 225
SynonymsV1re5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8823 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location20502299-20503195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20502561 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 88 (Q88R)
Ref Sequence ENSEMBL: ENSMUSP00000056068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061660]
Predicted Effect probably benign
Transcript: ENSMUST00000061660
AA Change: Q88R

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000056068
Gene: ENSMUSG00000043537
AA Change: Q88R

DomainStartEndE-ValueType
Pfam:TAS2R 1 287 8.9e-15 PFAM
Pfam:V1R 11 291 3.1e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 T A 8: 40,680,189 I232K probably benign Het
Ap5z1 T C 5: 142,474,436 L506P probably benign Het
Ceacam20 A T 7: 19,971,504 Y140F probably damaging Het
Chfr G A 5: 110,152,392 R334H probably damaging Het
Emx2 A G 19: 59,459,448 H78R probably damaging Het
Etnppl G A 3: 130,626,546 G204R probably damaging Het
Fah A G 7: 84,605,717 F3L possibly damaging Het
Galnt12 G T 4: 47,091,928 probably benign Het
Gbx1 A G 5: 24,505,053 S265P probably damaging Het
Gm17087 A G 17: 8,566,401 *157R probably null Het
Gm5426 A T 10: 96,136,771 I57F possibly damaging Het
Grin2a T A 16: 9,669,894 N380I possibly damaging Het
Grip1 C T 10: 119,975,951 T269I Het
Hace1 T C 10: 45,648,860 Y241H probably damaging Het
Hrc A G 7: 45,336,298 D291G possibly damaging Het
Ifi208 A G 1: 173,683,536 Y419C probably damaging Het
Ighv8-5 A G 12: 115,067,647 S91P probably damaging Het
Igkv15-103 T C 6: 68,437,871 L98P probably damaging Het
Igsf5 C T 16: 96,421,739 S61L possibly damaging Het
Ipo9 A G 1: 135,419,339 W138R probably damaging Het
Kank4 A T 4: 98,780,003 L69Q probably damaging Het
Kcnd3 T C 3: 105,667,014 I505T probably benign Het
Lrtm2 T A 6: 119,317,232 I313F probably damaging Het
Mug2 A T 6: 122,063,689 I733F possibly damaging Het
Myh2 A T 11: 67,185,474 R800S probably damaging Het
Myo1d A T 11: 80,601,745 I728N possibly damaging Het
Olfr519 A G 7: 108,893,948 I158T probably benign Het
Pdcd1 T C 1: 94,041,495 R33G probably benign Het
Polr1b T C 2: 129,125,537 F950S probably damaging Het
Prpf8 T A 11: 75,493,456 M697K probably benign Het
Psmc2 T A 5: 21,800,576 D218E probably damaging Het
Ptpn12 A G 5: 20,998,623 Y386H probably damaging Het
Rilpl2 C T 5: 124,468,653 R166K possibly damaging Het
Rtn4 T A 11: 29,706,609 N254K probably benign Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc35b2 T A 17: 45,566,968 H291Q probably damaging Het
Slc38a3 A C 9: 107,655,951 Y308D probably damaging Het
Snrpd2 T C 7: 19,152,610 V106A probably benign Het
Sybu C A 15: 44,677,602 A355S possibly damaging Het
Tes3-ps A T 13: 49,494,216 R189S probably benign Het
Trmo T C 4: 46,382,604 D164G probably damaging Het
Xkr9 T C 1: 13,672,608 V39A probably benign Het
Xpo1 A T 11: 23,267,752 M73L probably benign Het
Zbtb21 G A 16: 97,951,316 T589I probably damaging Het
Zbtb41 A G 1: 139,423,154 K2E probably damaging Het
Zfp105 A G 9: 122,930,503 K413R possibly damaging Het
Other mutations in Vmn1r225
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Vmn1r225 APN 17 20502819 missense probably damaging 1.00
IGL01830:Vmn1r225 APN 17 20502455 missense probably damaging 0.96
IGL02943:Vmn1r225 APN 17 20502305 missense possibly damaging 0.67
R0544:Vmn1r225 UTSW 17 20502456 missense probably benign 0.44
R1126:Vmn1r225 UTSW 17 20502326 missense probably benign 0.03
R1809:Vmn1r225 UTSW 17 20502656 missense probably benign 0.04
R1928:Vmn1r225 UTSW 17 20502809 missense probably benign 0.00
R2044:Vmn1r225 UTSW 17 20502590 missense possibly damaging 0.50
R2191:Vmn1r225 UTSW 17 20502885 missense probably damaging 0.98
R2206:Vmn1r225 UTSW 17 20502349 missense possibly damaging 0.56
R2207:Vmn1r225 UTSW 17 20502349 missense possibly damaging 0.56
R2680:Vmn1r225 UTSW 17 20502793 missense probably benign 0.00
R3740:Vmn1r225 UTSW 17 20502999 missense possibly damaging 0.56
R3807:Vmn1r225 UTSW 17 20502852 nonsense probably null
R4196:Vmn1r225 UTSW 17 20502975 missense probably benign 0.00
R4970:Vmn1r225 UTSW 17 20502569 missense possibly damaging 0.74
R5129:Vmn1r225 UTSW 17 20503116 missense probably damaging 1.00
R5130:Vmn1r225 UTSW 17 20502785 missense possibly damaging 0.81
R5187:Vmn1r225 UTSW 17 20502915 missense probably damaging 0.96
R5580:Vmn1r225 UTSW 17 20502839 missense probably damaging 1.00
R6563:Vmn1r225 UTSW 17 20502501 missense probably benign 0.03
R6674:Vmn1r225 UTSW 17 20503115 missense probably benign 0.06
R7003:Vmn1r225 UTSW 17 20503154 missense probably null 0.01
R7143:Vmn1r225 UTSW 17 20502384 missense probably benign 0.22
R7422:Vmn1r225 UTSW 17 20502797 missense probably benign 0.25
R7651:Vmn1r225 UTSW 17 20502349 missense possibly damaging 0.56
R7952:Vmn1r225 UTSW 17 20502327 missense probably damaging 0.98
R8097:Vmn1r225 UTSW 17 20502349 missense possibly damaging 0.56
R8696:Vmn1r225 UTSW 17 20503157 missense probably damaging 1.00
Z1177:Vmn1r225 UTSW 17 20502491 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- ATGGAGTCCAGGAACATGGC -3'
(R):5'- TCCTTTTGGTGGATGCATTCAAAG -3'

Sequencing Primer
(F):5'- CTTGGAATTCTGGGAAACATCTTTC -3'
(R):5'- GATTTCCTTCCAGTAGGAGT -3'
Posted On2021-07-15