Incidental Mutation 'R8824:Ptprc'
ID 673304
Institutional Source Beutler Lab
Gene Symbol Ptprc
Ensembl Gene ENSMUSG00000026395
Gene Name protein tyrosine phosphatase receptor type C
Synonyms Ly-5, T200, CD45, B220, Lyt-4
MMRRC Submission 068657-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8824 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 137990599-138103446 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 138041446 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 89 (K89*)
Ref Sequence ENSEMBL: ENSMUSP00000138800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182283] [ENSMUST00000182755] [ENSMUST00000183301] [ENSMUST00000193650] [ENSMUST00000195533]
AlphaFold P06800
Predicted Effect probably null
Transcript: ENSMUST00000182283
AA Change: K89*
SMART Domains Protein: ENSMUSP00000138800
Gene: ENSMUSG00000026395
AA Change: K89*

DomainStartEndE-ValueType
Pfam:PTP_N 7 32 4.2e-13 PFAM
low complexity region 33 66 N/A INTRINSIC
Pfam:CD45 72 131 2.3e-24 PFAM
FN3 235 319 2.28e0 SMART
FN3 335 413 3.48e-1 SMART
transmembrane domain 428 449 N/A INTRINSIC
PTPc 502 764 7.57e-127 SMART
PTPc 793 1079 1.39e-102 SMART
Predicted Effect probably null
Transcript: ENSMUST00000182755
AA Change: K65*
SMART Domains Protein: ENSMUSP00000138275
Gene: ENSMUSG00000026395
AA Change: K65*

DomainStartEndE-ValueType
Pfam:PTP_N 7 34 5.5e-13 PFAM
Pfam:CD45 48 107 2.3e-24 PFAM
FN3 211 295 2.28e0 SMART
FN3 311 389 3.48e-1 SMART
transmembrane domain 404 425 N/A INTRINSIC
PTPc 478 740 7.57e-127 SMART
PTPc 769 1055 1.39e-102 SMART
Predicted Effect probably null
Transcript: ENSMUST00000183301
AA Change: K228*
SMART Domains Protein: ENSMUSP00000138350
Gene: ENSMUSG00000026395
AA Change: K228*

DomainStartEndE-ValueType
Pfam:PTP_N 7 33 2.7e-13 PFAM
low complexity region 111 128 N/A INTRINSIC
low complexity region 170 205 N/A INTRINSIC
Pfam:CD45 211 270 2.1e-24 PFAM
FN3 374 458 2.28e0 SMART
FN3 474 552 3.48e-1 SMART
transmembrane domain 567 588 N/A INTRINSIC
PTPc 641 903 7.57e-127 SMART
PTPc 932 1218 1.39e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193650
SMART Domains Protein: ENSMUSP00000141524
Gene: ENSMUSG00000026395

DomainStartEndE-ValueType
Pfam:PTP_N 7 33 8.4e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000195533
AA Change: K138*
SMART Domains Protein: ENSMUSP00000142052
Gene: ENSMUSG00000026395
AA Change: K138*

DomainStartEndE-ValueType
Pfam:PTP_N 7 33 7.4e-11 PFAM
low complexity region 68 115 N/A INTRINSIC
Pfam:CD45 121 180 2.1e-22 PFAM
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl A T 2: 93,693,195 (GRCm39) V260D probably damaging Het
Adora2a G A 10: 75,162,013 (GRCm39) A51T probably damaging Het
Afg1l G A 10: 42,314,383 (GRCm39) P128S possibly damaging Het
Ago4 C A 4: 126,400,977 (GRCm39) V623L probably benign Het
Akap11 A T 14: 78,753,787 (GRCm39) N112K Het
C1ra A T 6: 124,494,654 (GRCm39) I306F probably damaging Het
Ccdc73 A G 2: 104,822,222 (GRCm39) N724D possibly damaging Het
Cd248 A G 19: 5,119,645 (GRCm39) I498V probably benign Het
Clrn1 A T 3: 58,792,314 (GRCm39) S50T probably benign Het
Col7a1 A G 9: 108,796,093 (GRCm39) K1553R unknown Het
Cxcr6 A C 9: 123,640,006 (GRCm39) T343P probably benign Het
Cyp11b2 T A 15: 74,727,914 (GRCm39) Q56L probably damaging Het
Dip2a A G 10: 76,114,320 (GRCm39) probably null Het
Dnmbp A G 19: 43,838,276 (GRCm39) V742A probably benign Het
Dusp16 A T 6: 134,716,732 (GRCm39) S192T probably benign Het
Ehbp1 A T 11: 22,182,053 (GRCm39) D87E probably damaging Het
Fgl1 A G 8: 41,652,748 (GRCm39) V150A probably benign Het
Flt3 T C 5: 147,271,673 (GRCm39) D873G probably damaging Het
Gart T C 16: 91,427,591 (GRCm39) D469G possibly damaging Het
Gm28168 T G 1: 117,875,625 (GRCm39) S85A probably benign Het
Golgb1 A G 16: 36,736,051 (GRCm39) D1807G probably benign Het
Grm8 A G 6: 27,761,351 (GRCm39) L291S probably damaging Het
Gucy2d C T 7: 98,092,676 (GRCm39) P18S possibly damaging Het
Ifna15 C T 4: 88,475,998 (GRCm39) C162Y probably damaging Het
Iqub C A 6: 24,479,307 (GRCm39) E412* probably null Het
Krt4 T A 15: 101,829,077 (GRCm39) D312V Het
Krtap26-1 T C 16: 88,444,324 (GRCm39) Y99C probably damaging Het
Krtap26-1 A T 16: 88,444,303 (GRCm39) I106N probably damaging Het
Lipn T C 19: 34,062,116 (GRCm39) I357T probably benign Het
Lrrc14b A G 13: 74,512,068 (GRCm39) L4P probably damaging Het
Mrgpra9 A T 7: 46,885,041 (GRCm39) C209S probably benign Het
Myh7b A G 2: 155,472,301 (GRCm39) N1291D probably benign Het
Myo5a A G 9: 75,074,328 (GRCm39) T746A probably damaging Het
Myom2 A C 8: 15,164,169 (GRCm39) E1021D possibly damaging Het
Ncoa2 C T 1: 13,247,409 (GRCm39) R338H probably benign Het
Ncor2 A G 5: 125,195,821 (GRCm39) F91L Het
Neb C G 2: 52,106,923 (GRCm39) A4407P probably damaging Het
Or10u4 C T 10: 129,801,661 (GRCm39) V297M probably damaging Het
Or1j18 A T 2: 36,625,203 (GRCm39) Y290F probably damaging Het
Or4b1b A G 2: 90,126,356 (GRCm39) I283T probably damaging Het
Or5d47 A G 2: 87,804,347 (GRCm39) F221L probably benign Het
Or5p76 T G 7: 108,122,350 (GRCm39) Y269S probably benign Het
Or5w12 T C 2: 87,502,304 (GRCm39) M136V possibly damaging Het
Peg10 T TCCC 6: 4,756,451 (GRCm39) probably benign Het
Piwil4 C A 9: 14,638,771 (GRCm39) K298N probably benign Het
Prkcz G A 4: 155,429,285 (GRCm39) probably benign Het
Prkg2 G A 5: 99,090,067 (GRCm39) P691L possibly damaging Het
Rapgef3 C T 15: 97,664,789 (GRCm39) A25T probably benign Het
Rreb1 C T 13: 38,114,492 (GRCm39) T617I probably damaging Het
Rsph1 A C 17: 31,492,350 (GRCm39) V72G possibly damaging Het
Shc2 A G 10: 79,473,536 (GRCm39) V50A probably benign Het
Slc38a9 G A 13: 112,838,021 (GRCm39) R262H probably benign Het
Slco6c1 T A 1: 97,055,884 (GRCm39) N6Y possibly damaging Het
Smarca5 A G 8: 81,431,961 (GRCm39) F886L probably benign Het
Tas1r2 A G 4: 139,381,074 (GRCm39) probably benign Het
Tnrc6c T A 11: 117,630,680 (GRCm39) probably benign Het
Trim30b T A 7: 104,007,113 (GRCm39) probably benign Het
Trim55 T C 3: 19,727,126 (GRCm39) S398P probably benign Het
Ttc39c T A 18: 12,820,003 (GRCm39) probably benign Het
Ubxn10 A G 4: 138,463,178 (GRCm39) probably null Het
Usf3 A G 16: 44,035,976 (GRCm39) N152S probably benign Het
Vps13b T A 15: 35,533,445 (GRCm39) V839E probably damaging Het
Zeb1 T A 18: 5,748,680 (GRCm39) probably benign Het
Zfp780b T C 7: 27,662,893 (GRCm39) Y554C probably benign Het
Zhx2 C T 15: 57,684,676 (GRCm39) T15I probably damaging Het
Other mutations in Ptprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
lochy APN 1 138,011,528 (GRCm39) splice site probably benign
IGL00486:Ptprc APN 1 138,043,359 (GRCm39) missense probably damaging 0.97
IGL00771:Ptprc APN 1 138,041,415 (GRCm39) missense probably benign 0.00
IGL00833:Ptprc APN 1 138,006,230 (GRCm39) missense possibly damaging 0.55
IGL00919:Ptprc APN 1 138,041,380 (GRCm39) missense probably damaging 1.00
IGL01020:Ptprc APN 1 138,047,911 (GRCm39) critical splice acceptor site probably null 0.00
IGL01024:Ptprc APN 1 138,008,650 (GRCm39) missense probably damaging 1.00
IGL01302:Ptprc APN 1 138,027,369 (GRCm39) missense possibly damaging 0.82
IGL01548:Ptprc APN 1 138,027,219 (GRCm39) critical splice donor site probably null 0.00
IGL01620:Ptprc APN 1 137,996,148 (GRCm39) missense possibly damaging 0.88
IGL01775:Ptprc APN 1 137,992,497 (GRCm39) missense probably damaging 1.00
IGL01820:Ptprc APN 1 137,993,936 (GRCm39) missense probably damaging 1.00
IGL02340:Ptprc APN 1 137,998,957 (GRCm39) missense probably damaging 1.00
IGL02943:Ptprc APN 1 138,027,251 (GRCm39) missense probably damaging 0.99
IGL03169:Ptprc APN 1 138,041,357 (GRCm39) missense probably benign 0.15
IGL03308:Ptprc APN 1 138,054,058 (GRCm39) missense possibly damaging 0.70
IGL03404:Ptprc APN 1 138,020,739 (GRCm39) missense probably damaging 1.00
belittle UTSW 1 138,137,493 (GRCm38) intron probably benign
Benighted UTSW 1 138,054,039 (GRCm39) critical splice donor site probably null
bletchley UTSW 1 138,045,600 (GRCm39) missense probably benign
Blush UTSW 1 138,045,458 (GRCm39) intron probably benign
bruise UTSW 1 137,992,509 (GRCm39) missense probably damaging 1.00
chor_muang UTSW 1 138,041,300 (GRCm39) critical splice donor site probably null
crystal UTSW 1 137,999,993 (GRCm39) critical splice donor site probably null
Dumpling UTSW 1 137,995,628 (GRCm39) missense probably damaging 1.00
fluorescent UTSW 1 138,028,930 (GRCm39) missense probably damaging 0.97
fuchsia UTSW 1 138,028,779 (GRCm39) critical splice donor site probably null
Gentian UTSW 1 137,995,623 (GRCm39) critical splice donor site probably null
guotie UTSW 1 137,996,139 (GRCm39) nonsense probably null
guotie2 UTSW 1 138,022,037 (GRCm39) missense probably damaging 0.97
Guotie3 UTSW 1 138,006,189 (GRCm39) missense possibly damaging 0.92
Gyoza UTSW 1 138,011,305 (GRCm39) missense probably damaging 1.00
Half_measure UTSW 1 137,998,987 (GRCm39) missense probably damaging 0.98
jirisan UTSW 1 138,041,416 (GRCm39) nonsense probably null
mauve UTSW 1 138,027,423 (GRCm39) missense probably benign
Perverse UTSW 1 138,028,782 (GRCm39) missense probably benign 0.02
petechiae UTSW 1 138,041,446 (GRCm39) nonsense probably null
ultra UTSW 1 138,006,183 (GRCm39) critical splice donor site probably null
violaceous UTSW 1 138,011,377 (GRCm39) missense possibly damaging 0.77
R0013:Ptprc UTSW 1 138,041,297 (GRCm39) splice site probably null
R0189:Ptprc UTSW 1 138,010,453 (GRCm39) missense probably benign 0.10
R0390:Ptprc UTSW 1 138,050,313 (GRCm39) missense possibly damaging 0.71
R0504:Ptprc UTSW 1 138,016,435 (GRCm39) missense probably damaging 1.00
R0602:Ptprc UTSW 1 138,017,223 (GRCm39) splice site probably benign
R0627:Ptprc UTSW 1 137,996,058 (GRCm39) missense probably damaging 0.99
R0632:Ptprc UTSW 1 138,001,348 (GRCm39) missense probably benign 0.01
R0751:Ptprc UTSW 1 138,020,668 (GRCm39) missense probably damaging 1.00
R0839:Ptprc UTSW 1 138,028,870 (GRCm39) missense possibly damaging 0.47
R0942:Ptprc UTSW 1 137,996,139 (GRCm39) nonsense probably null
R0943:Ptprc UTSW 1 138,038,902 (GRCm39) missense probably damaging 0.96
R1159:Ptprc UTSW 1 138,000,057 (GRCm39) missense probably damaging 1.00
R1442:Ptprc UTSW 1 138,000,050 (GRCm39) missense probably damaging 1.00
R1489:Ptprc UTSW 1 138,047,824 (GRCm39) missense possibly damaging 0.91
R1728:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1728:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1728:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1728:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1728:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1729:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1729:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1729:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1729:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1729:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1730:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1730:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1730:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1730:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1730:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1739:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1739:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1739:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1739:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1739:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1762:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1762:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1762:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1762:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1762:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1783:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1783:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1783:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1783:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1783:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1784:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1784:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1784:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1784:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1784:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1785:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1785:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1785:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1785:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1785:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1862:Ptprc UTSW 1 138,039,965 (GRCm39) missense probably benign 0.13
R2145:Ptprc UTSW 1 138,001,419 (GRCm39) missense probably damaging 1.00
R2290:Ptprc UTSW 1 138,038,926 (GRCm39) missense probably benign 0.00
R2403:Ptprc UTSW 1 138,016,270 (GRCm39) missense probably damaging 1.00
R2439:Ptprc UTSW 1 137,993,890 (GRCm39) missense possibly damaging 0.67
R2887:Ptprc UTSW 1 138,007,916 (GRCm39) missense probably damaging 1.00
R2906:Ptprc UTSW 1 137,992,272 (GRCm39) missense possibly damaging 0.93
R3774:Ptprc UTSW 1 137,992,511 (GRCm39) missense probably damaging 0.97
R3775:Ptprc UTSW 1 137,992,511 (GRCm39) missense probably damaging 0.97
R3776:Ptprc UTSW 1 137,992,511 (GRCm39) missense probably damaging 0.97
R3834:Ptprc UTSW 1 138,011,305 (GRCm39) missense probably damaging 1.00
R4019:Ptprc UTSW 1 138,006,254 (GRCm39) missense probably damaging 1.00
R4377:Ptprc UTSW 1 137,995,663 (GRCm39) missense probably benign 0.04
R4580:Ptprc UTSW 1 137,998,989 (GRCm39) missense probably benign 0.09
R4923:Ptprc UTSW 1 138,006,236 (GRCm39) missense possibly damaging 0.93
R4925:Ptprc UTSW 1 138,027,235 (GRCm39) missense probably benign 0.04
R4937:Ptprc UTSW 1 138,017,238 (GRCm39) missense probably damaging 1.00
R4970:Ptprc UTSW 1 138,022,037 (GRCm39) missense probably damaging 0.97
R5112:Ptprc UTSW 1 138,022,037 (GRCm39) missense probably damaging 0.97
R5145:Ptprc UTSW 1 138,017,304 (GRCm39) missense probably benign 0.07
R5158:Ptprc UTSW 1 138,102,822 (GRCm39) missense possibly damaging 0.75
R5223:Ptprc UTSW 1 138,045,600 (GRCm39) missense probably benign
R5593:Ptprc UTSW 1 138,045,458 (GRCm39) intron probably benign
R5689:Ptprc UTSW 1 138,045,515 (GRCm39) missense probably benign 0.01
R5885:Ptprc UTSW 1 138,016,246 (GRCm39) missense probably damaging 1.00
R6010:Ptprc UTSW 1 138,028,794 (GRCm39) missense probably benign 0.09
R6026:Ptprc UTSW 1 137,998,987 (GRCm39) missense probably damaging 0.98
R6047:Ptprc UTSW 1 138,028,779 (GRCm39) critical splice donor site probably null
R6173:Ptprc UTSW 1 137,995,628 (GRCm39) missense probably damaging 1.00
R6328:Ptprc UTSW 1 138,041,416 (GRCm39) nonsense probably null
R6383:Ptprc UTSW 1 138,006,189 (GRCm39) missense possibly damaging 0.92
R6436:Ptprc UTSW 1 138,011,377 (GRCm39) missense possibly damaging 0.77
R6492:Ptprc UTSW 1 138,041,300 (GRCm39) critical splice donor site probably null
R6520:Ptprc UTSW 1 138,007,881 (GRCm39) nonsense probably null
R6805:Ptprc UTSW 1 137,995,623 (GRCm39) critical splice donor site probably null
R6830:Ptprc UTSW 1 137,999,993 (GRCm39) critical splice donor site probably null
R6847:Ptprc UTSW 1 138,016,283 (GRCm39) missense probably damaging 0.99
R6960:Ptprc UTSW 1 138,006,183 (GRCm39) critical splice donor site probably null
R6995:Ptprc UTSW 1 138,016,482 (GRCm39) missense probably damaging 1.00
R7009:Ptprc UTSW 1 137,992,291 (GRCm39) missense probably damaging 0.97
R7041:Ptprc UTSW 1 138,054,047 (GRCm39) missense probably benign 0.04
R7055:Ptprc UTSW 1 138,017,309 (GRCm39) missense probably damaging 1.00
R7098:Ptprc UTSW 1 138,027,423 (GRCm39) missense probably benign
R7164:Ptprc UTSW 1 138,045,600 (GRCm39) missense probably benign
R7188:Ptprc UTSW 1 137,998,918 (GRCm39) missense probably damaging 1.00
R7191:Ptprc UTSW 1 138,028,782 (GRCm39) missense probably benign 0.02
R7204:Ptprc UTSW 1 138,045,600 (GRCm39) missense probably benign
R7316:Ptprc UTSW 1 137,992,509 (GRCm39) missense probably damaging 1.00
R7644:Ptprc UTSW 1 137,995,645 (GRCm39) missense probably benign 0.01
R7948:Ptprc UTSW 1 137,992,314 (GRCm39) missense probably benign 0.45
R8029:Ptprc UTSW 1 138,006,197 (GRCm39) missense probably damaging 1.00
R8677:Ptprc UTSW 1 138,011,335 (GRCm39) missense probably damaging 1.00
R8704:Ptprc UTSW 1 138,043,362 (GRCm39) missense probably benign 0.34
R8921:Ptprc UTSW 1 138,054,039 (GRCm39) critical splice donor site probably null
R8998:Ptprc UTSW 1 138,028,930 (GRCm39) missense probably damaging 0.97
R8999:Ptprc UTSW 1 138,028,930 (GRCm39) missense probably damaging 0.97
R9154:Ptprc UTSW 1 138,016,302 (GRCm39) missense probably damaging 1.00
R9388:Ptprc UTSW 1 138,011,380 (GRCm39) missense possibly damaging 0.87
R9428:Ptprc UTSW 1 138,041,485 (GRCm39) missense probably benign 0.01
R9467:Ptprc UTSW 1 137,993,960 (GRCm39) missense probably damaging 1.00
R9468:Ptprc UTSW 1 138,044,754 (GRCm39) missense probably benign 0.01
R9479:Ptprc UTSW 1 138,001,388 (GRCm39) missense probably benign 0.38
R9526:Ptprc UTSW 1 137,996,111 (GRCm39) missense probably benign 0.02
R9632:Ptprc UTSW 1 138,008,627 (GRCm39) missense probably damaging 1.00
R9710:Ptprc UTSW 1 138,008,627 (GRCm39) missense probably damaging 1.00
R9714:Ptprc UTSW 1 138,008,687 (GRCm39) missense probably damaging 1.00
R9777:Ptprc UTSW 1 138,047,901 (GRCm39) missense
Z1177:Ptprc UTSW 1 137,995,645 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTTGCTCTAAATACCCAGATAGAG -3'
(R):5'- TGCTGAGTACTGAATTTGAAACCC -3'

Sequencing Primer
(F):5'- GAGAAATTGACATTCACCTGGTG -3'
(R):5'- AGCTGCCATGTTTGGGA -3'
Posted On 2021-07-15