Mutagenetix > Incidental Mutation

Incidental Mutation 'R8824:Ptprc'

673304

Institutional Source

Beutler Lab

Gene Symbol

Ptprc

Ensembl Gene

ENSMUSG00000026395

Gene Name

protein tyrosine phosphatase, receptor type, C

Synonyms

B220, Ly-5, Lyt-4, CD45, T200

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8824 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

138062861-138175708 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 138113708 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 89 (K89*)

Ref Sequence

ENSEMBL: ENSMUSP00000138800 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000182283] [ENSMUST00000182755] [ENSMUST00000183301] [ENSMUST00000193650] [ENSMUST00000195533]

AlphaFold

P06800

Predicted Effect

probably null
Transcript: ENSMUST00000182283
AA Change: K89*

SMART Domains

Protein: ENSMUSP00000138800
Gene: ENSMUSG00000026395
AA Change: K89*

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	32	4.2e-13	PFAM
low complexity region	33	66	N/A	INTRINSIC
Pfam:CD45	72	131	2.3e-24	PFAM
FN3	235	319	2.28e0	SMART
FN3	335	413	3.48e-1	SMART
transmembrane domain	428	449	N/A	INTRINSIC
PTPc	502	764	7.57e-127	SMART
PTPc	793	1079	1.39e-102	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000182755
AA Change: K65*

SMART Domains

Protein: ENSMUSP00000138275
Gene: ENSMUSG00000026395
AA Change: K65*

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	34	5.5e-13	PFAM
Pfam:CD45	48	107	2.3e-24	PFAM
FN3	211	295	2.28e0	SMART
FN3	311	389	3.48e-1	SMART
transmembrane domain	404	425	N/A	INTRINSIC
PTPc	478	740	7.57e-127	SMART
PTPc	769	1055	1.39e-102	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000183301
AA Change: K228*

SMART Domains

Protein: ENSMUSP00000138350
Gene: ENSMUSG00000026395
AA Change: K228*

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	33	2.7e-13	PFAM
low complexity region	111	128	N/A	INTRINSIC
low complexity region	170	205	N/A	INTRINSIC
Pfam:CD45	211	270	2.1e-24	PFAM
FN3	374	458	2.28e0	SMART
FN3	474	552	3.48e-1	SMART
transmembrane domain	567	588	N/A	INTRINSIC
PTPc	641	903	7.57e-127	SMART
PTPc	932	1218	1.39e-102	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000193650

SMART Domains

Protein: ENSMUSP00000141524
Gene: ENSMUSG00000026395

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	33	8.4e-12	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000195533
AA Change: K138*

SMART Domains

Protein: ENSMUSP00000142052
Gene: ENSMUSG00000026395
AA Change: K138*

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	33	7.4e-11	PFAM
low complexity region	68	115	N/A	INTRINSIC
Pfam:CD45	121	180	2.1e-22	PFAM

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Accsl	A	T	2: 93,862,850	V260D	probably damaging	Het
Adora2a	G	A	10: 75,326,179	A51T	probably damaging	Het
Afg1l	G	A	10: 42,438,387	P128S	possibly damaging	Het
Ago4	C	A	4: 126,507,184	V623L	probably benign	Het
Akap11	A	T	14: 78,516,347	N112K		Het
C1ra	A	T	6: 124,517,695	I306F	probably damaging	Het
Ccdc73	A	G	2: 104,991,877	N724D	possibly damaging	Het
Cd248	A	G	19: 5,069,617	I498V	probably benign	Het
Clrn1	A	T	3: 58,884,893	S50T	probably benign	Het
Col7a1	A	G	9: 108,967,025	K1553R	unknown	Het
Cxcr6	A	C	9: 123,810,941	T343P	probably benign	Het
Cyp11b2	T	A	15: 74,856,065	Q56L	probably damaging	Het
Dip2a	A	G	10: 76,278,486		probably null	Het
Dnmbp	A	G	19: 43,849,837	V742A	probably benign	Het
Dusp16	A	T	6: 134,739,769	S192T	probably benign	Het
Ehbp1	A	T	11: 22,232,053	D87E	probably damaging	Het
Fgl1	A	G	8: 41,199,711	V150A	probably benign	Het
Flt3	T	C	5: 147,334,863	D873G	probably damaging	Het
Gart	T	C	16: 91,630,703	D469G	possibly damaging	Het
Gm28168	T	G	1: 117,947,895	S85A	probably benign	Het
Golgb1	A	G	16: 36,915,689	D1807G	probably benign	Het
Grm8	A	G	6: 27,761,352	L291S	probably damaging	Het
Gucy2d	C	T	7: 98,443,469	P18S	possibly damaging	Het
Ifna15	C	T	4: 88,557,761	C162Y	probably damaging	Het
Iqub	C	A	6: 24,479,308	E412*	probably null	Het
Krt4	T	A	15: 101,920,642	D312V		Het
Krtap26-1	A	T	16: 88,647,415	I106N	probably damaging	Het
Krtap26-1	T	C	16: 88,647,436	Y99C	probably damaging	Het
Lipn	T	C	19: 34,084,716	I357T	probably benign	Het
Lrrc14b	A	G	13: 74,363,949	L4P	probably damaging	Het
Mrgpra9	A	T	7: 47,235,293	C209S	probably benign	Het
Myh7b	A	G	2: 155,630,381	N1291D	probably benign	Het
Myo5a	A	G	9: 75,167,046	T746A	probably damaging	Het
Myom2	A	C	8: 15,114,169	E1021D	possibly damaging	Het
Ncoa2	C	T	1: 13,177,185	R338H	probably benign	Het
Ncor2	A	G	5: 125,118,757	F91L		Het
Neb	C	G	2: 52,216,911	A4407P	probably damaging	Het
Olfr1135	T	C	2: 87,671,960	M136V	possibly damaging	Het
Olfr1272	A	G	2: 90,296,012	I283T	probably damaging	Het
Olfr347	A	T	2: 36,735,191	Y290F	probably damaging	Het
Olfr502	T	G	7: 108,523,143	Y269S	probably benign	Het
Olfr74	A	G	2: 87,974,003	F221L	probably benign	Het
Olfr819	C	T	10: 129,965,792	V297M	probably damaging	Het
Peg10	T	TCCC	6: 4,756,451		probably benign	Het
Piwil4	C	A	9: 14,727,475	K298N	probably benign	Het
Prkcz	G	A	4: 155,344,828		probably benign	Het
Prkg2	G	A	5: 98,942,208	P691L	possibly damaging	Het
Rapgef3	C	T	15: 97,766,908	A25T	probably benign	Het
Rreb1	C	T	13: 37,930,516	T617I	probably damaging	Het
Rsph1	A	C	17: 31,273,376	V72G	possibly damaging	Het
Shc2	A	G	10: 79,637,702	V50A	probably benign	Het
Slc38a9	G	A	13: 112,701,487	R262H	probably benign	Het
Slco6c1	T	A	1: 97,128,159	N6Y	possibly damaging	Het
Smarca5	A	G	8: 80,705,332	F886L	probably benign	Het
Tas1r2	A	G	4: 139,653,763		probably benign	Het
Tnrc6c	T	A	11: 117,739,854		probably benign	Het
Trim30b	T	A	7: 104,357,906		probably benign	Het
Trim55	T	C	3: 19,672,962	S398P	probably benign	Het
Ttc39c	T	A	18: 12,686,946		probably benign	Het
Ubxn10	A	G	4: 138,735,867		probably null	Het
Usf3	A	G	16: 44,215,613	N152S	probably benign	Het
Vps13b	T	A	15: 35,533,299	V839E	probably damaging	Het
Zeb1	T	A	18: 5,748,680		probably benign	Het
Zfp780b	T	C	7: 27,963,468	Y554C	probably benign	Het
Zhx2	C	T	15: 57,821,280	T15I	probably damaging	Het

Other mutations in Ptprc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
lochy	APN	1	138083790	splice site	probably benign
IGL00486:Ptprc	APN	1	138115621	missense	probably damaging	0.97
IGL00771:Ptprc	APN	1	138113677	missense	probably benign	0.00
IGL00833:Ptprc	APN	1	138078492	missense	possibly damaging	0.55
IGL00919:Ptprc	APN	1	138113642	missense	probably damaging	1.00
IGL01020:Ptprc	APN	1	138120173	critical splice acceptor site	probably null	0.00
IGL01024:Ptprc	APN	1	138080912	missense	probably damaging	1.00
IGL01302:Ptprc	APN	1	138099631	missense	possibly damaging	0.82
IGL01548:Ptprc	APN	1	138099481	critical splice donor site	probably null	0.00
IGL01620:Ptprc	APN	1	138068410	missense	possibly damaging	0.88
IGL01775:Ptprc	APN	1	138064759	missense	probably damaging	1.00
IGL01820:Ptprc	APN	1	138066198	missense	probably damaging	1.00
IGL02340:Ptprc	APN	1	138071219	missense	probably damaging	1.00
IGL02943:Ptprc	APN	1	138099513	missense	probably damaging	0.99
IGL03169:Ptprc	APN	1	138113619	missense	probably benign	0.15
IGL03308:Ptprc	APN	1	138126320	missense	possibly damaging	0.70
IGL03404:Ptprc	APN	1	138093001	missense	probably damaging	1.00
belittle	UTSW	1	138137493	intron	probably benign
Benighted	UTSW	1	138126301	critical splice donor site	probably null
bletchley	UTSW	1	138117862	missense	probably benign
Blush	UTSW	1	138117720	intron	probably benign
bruise	UTSW	1	138064771	missense	probably damaging	1.00
chor_muang	UTSW	1	138113562	critical splice donor site	probably null
crystal	UTSW	1	138072255	critical splice donor site	probably null
Dumpling	UTSW	1	138067890	missense	probably damaging	1.00
fluorescent	UTSW	1	138101192	missense	probably damaging	0.97
fuchsia	UTSW	1	138101041	critical splice donor site	probably null
Gentian	UTSW	1	138067885	critical splice donor site	probably null
guotie	UTSW	1	138068401	nonsense	probably null
guotie2	UTSW	1	138094299	missense	probably damaging	0.97
Guotie3	UTSW	1	138078451	missense	possibly damaging	0.92
Gyoza	UTSW	1	138083567	missense	probably damaging	1.00
Half_measure	UTSW	1	138071249	missense	probably damaging	0.98
jirisan	UTSW	1	138113678	nonsense	probably null
mauve	UTSW	1	138099685	missense	probably benign
Perverse	UTSW	1	138101044	missense	probably benign	0.02
petechiae	UTSW	1	138113708	nonsense	probably null
ultra	UTSW	1	138078445	critical splice donor site	probably null
violaceous	UTSW	1	138083639	missense	possibly damaging	0.77
R0013:Ptprc	UTSW	1	138113559	splice site	probably null
R0189:Ptprc	UTSW	1	138082715	missense	probably benign	0.10
R0390:Ptprc	UTSW	1	138122575	missense	possibly damaging	0.71
R0504:Ptprc	UTSW	1	138088697	missense	probably damaging	1.00
R0602:Ptprc	UTSW	1	138089485	splice site	probably benign
R0627:Ptprc	UTSW	1	138068320	missense	probably damaging	0.99
R0632:Ptprc	UTSW	1	138073610	missense	probably benign	0.01
R0751:Ptprc	UTSW	1	138092930	missense	probably damaging	1.00
R0839:Ptprc	UTSW	1	138101132	missense	possibly damaging	0.47
R0942:Ptprc	UTSW	1	138068401	nonsense	probably null
R0943:Ptprc	UTSW	1	138111164	missense	probably damaging	0.96
R1159:Ptprc	UTSW	1	138072319	missense	probably damaging	1.00
R1442:Ptprc	UTSW	1	138072312	missense	probably damaging	1.00
R1489:Ptprc	UTSW	1	138120086	missense	possibly damaging	0.91
R1728:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1728:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1728:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1728:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1728:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1729:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1729:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1729:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1729:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1729:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1730:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1730:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1730:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1730:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1730:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1739:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1739:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1739:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1739:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1739:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1762:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1762:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1762:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1762:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1762:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1783:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1783:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1783:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1783:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1783:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1784:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1784:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1784:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1784:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1784:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1785:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1785:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1785:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1785:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1785:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1862:Ptprc	UTSW	1	138112227	missense	probably benign	0.13
R2145:Ptprc	UTSW	1	138073681	missense	probably damaging	1.00
R2290:Ptprc	UTSW	1	138111188	missense	probably benign	0.00
R2403:Ptprc	UTSW	1	138088532	missense	probably damaging	1.00
R2439:Ptprc	UTSW	1	138066152	missense	possibly damaging	0.67
R2887:Ptprc	UTSW	1	138080178	missense	probably damaging	1.00
R2906:Ptprc	UTSW	1	138064534	missense	possibly damaging	0.93
R3774:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3775:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3776:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3834:Ptprc	UTSW	1	138083567	missense	probably damaging	1.00
R4019:Ptprc	UTSW	1	138078516	missense	probably damaging	1.00
R4377:Ptprc	UTSW	1	138067925	missense	probably benign	0.04
R4580:Ptprc	UTSW	1	138071251	missense	probably benign	0.09
R4923:Ptprc	UTSW	1	138078498	missense	possibly damaging	0.93
R4925:Ptprc	UTSW	1	138099497	missense	probably benign	0.04
R4937:Ptprc	UTSW	1	138089500	missense	probably damaging	1.00
R4970:Ptprc	UTSW	1	138094299	missense	probably damaging	0.97
R5112:Ptprc	UTSW	1	138094299	missense	probably damaging	0.97
R5145:Ptprc	UTSW	1	138089566	missense	probably benign	0.07
R5158:Ptprc	UTSW	1	138175084	missense	possibly damaging	0.75
R5223:Ptprc	UTSW	1	138117862	missense	probably benign
R5593:Ptprc	UTSW	1	138117720	intron	probably benign
R5689:Ptprc	UTSW	1	138117777	missense	probably benign	0.01
R5885:Ptprc	UTSW	1	138088508	missense	probably damaging	1.00
R6010:Ptprc	UTSW	1	138101056	missense	probably benign	0.09
R6026:Ptprc	UTSW	1	138071249	missense	probably damaging	0.98
R6047:Ptprc	UTSW	1	138101041	critical splice donor site	probably null
R6173:Ptprc	UTSW	1	138067890	missense	probably damaging	1.00
R6328:Ptprc	UTSW	1	138113678	nonsense	probably null
R6383:Ptprc	UTSW	1	138078451	missense	possibly damaging	0.92
R6436:Ptprc	UTSW	1	138083639	missense	possibly damaging	0.77
R6492:Ptprc	UTSW	1	138113562	critical splice donor site	probably null
R6520:Ptprc	UTSW	1	138080143	nonsense	probably null
R6805:Ptprc	UTSW	1	138067885	critical splice donor site	probably null
R6830:Ptprc	UTSW	1	138072255	critical splice donor site	probably null
R6847:Ptprc	UTSW	1	138088545	missense	probably damaging	0.99
R6960:Ptprc	UTSW	1	138078445	critical splice donor site	probably null
R6995:Ptprc	UTSW	1	138088744	missense	probably damaging	1.00
R7009:Ptprc	UTSW	1	138064553	missense	probably damaging	0.97
R7041:Ptprc	UTSW	1	138126309	missense	probably benign	0.04
R7055:Ptprc	UTSW	1	138089571	missense	probably damaging	1.00
R7098:Ptprc	UTSW	1	138099685	missense	probably benign
R7164:Ptprc	UTSW	1	138117862	missense	probably benign
R7188:Ptprc	UTSW	1	138071180	missense	probably damaging	1.00
R7191:Ptprc	UTSW	1	138101044	missense	probably benign	0.02
R7204:Ptprc	UTSW	1	138117862	missense	probably benign
R7316:Ptprc	UTSW	1	138064771	missense	probably damaging	1.00
R7644:Ptprc	UTSW	1	138067907	missense	probably benign	0.01
R7948:Ptprc	UTSW	1	138064576	missense	probably benign	0.45
R8029:Ptprc	UTSW	1	138078459	missense	probably damaging	1.00
R8677:Ptprc	UTSW	1	138083597	missense	probably damaging	1.00
R8704:Ptprc	UTSW	1	138115624	missense	probably benign	0.34
R8921:Ptprc	UTSW	1	138126301	critical splice donor site	probably null
R8998:Ptprc	UTSW	1	138101192	missense	probably damaging	0.97
R8999:Ptprc	UTSW	1	138101192	missense	probably damaging	0.97
R9154:Ptprc	UTSW	1	138088564	missense	probably damaging	1.00
R9388:Ptprc	UTSW	1	138083642	missense	possibly damaging	0.87
R9428:Ptprc	UTSW	1	138113747	missense	probably benign	0.01
R9467:Ptprc	UTSW	1	138066222	missense	probably damaging	1.00
R9468:Ptprc	UTSW	1	138117016	missense	probably benign	0.01
R9479:Ptprc	UTSW	1	138073650	missense	probably benign	0.38
R9526:Ptprc	UTSW	1	138068373	missense	probably benign	0.02
R9632:Ptprc	UTSW	1	138080889	missense	probably damaging	1.00
R9710:Ptprc	UTSW	1	138080889	missense	probably damaging	1.00
R9714:Ptprc	UTSW	1	138080949	missense	probably damaging	1.00
R9777:Ptprc	UTSW	1	138120163	missense
Z1177:Ptprc	UTSW	1	138067907	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGTTGCTCTAAATACCCAGATAGAG -3'
(R):5'- TGCTGAGTACTGAATTTGAAACCC -3'

Sequencing Primer
(F):5'- GAGAAATTGACATTCACCTGGTG -3'
(R):5'- AGCTGCCATGTTTGGGA -3'

Posted On

2021-07-15