Incidental Mutation 'R8824:Myh7b'
ID 673311
Institutional Source Beutler Lab
Gene Symbol Myh7b
Ensembl Gene ENSMUSG00000074652
Gene Name myosin, heavy chain 7B, cardiac muscle, beta
Synonyms Myh14
MMRRC Submission 068657-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8824 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 155453132-155476227 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 155472301 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 1291 (N1291D)
Ref Sequence ENSEMBL: ENSMUSP00000090672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041059] [ENSMUST00000092995] [ENSMUST00000103140]
AlphaFold A2AQP0
Predicted Effect probably benign
Transcript: ENSMUST00000041059
SMART Domains Protein: ENSMUSP00000037574
Gene: ENSMUSG00000038324

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 38 53 N/A INTRINSIC
Pfam:DUF3689 407 714 5.2e-135 PFAM
low complexity region 724 735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092995
AA Change: N1291D

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000090672
Gene: ENSMUSG00000074652
AA Change: N1291D

DomainStartEndE-ValueType
Pfam:Myosin_N 32 72 4.7e-14 PFAM
MYSc 78 786 N/A SMART
IQ 787 809 2.6e0 SMART
Pfam:Myosin_tail_1 850 1931 5.5e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103140
SMART Domains Protein: ENSMUSP00000099429
Gene: ENSMUSG00000038324

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 38 53 N/A INTRINSIC
Pfam:DUF3689 399 710 1.1e-138 PFAM
low complexity region 716 727 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer comprised of two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl A T 2: 93,693,195 (GRCm39) V260D probably damaging Het
Adora2a G A 10: 75,162,013 (GRCm39) A51T probably damaging Het
Afg1l G A 10: 42,314,383 (GRCm39) P128S possibly damaging Het
Ago4 C A 4: 126,400,977 (GRCm39) V623L probably benign Het
Akap11 A T 14: 78,753,787 (GRCm39) N112K Het
C1ra A T 6: 124,494,654 (GRCm39) I306F probably damaging Het
Ccdc73 A G 2: 104,822,222 (GRCm39) N724D possibly damaging Het
Cd248 A G 19: 5,119,645 (GRCm39) I498V probably benign Het
Clrn1 A T 3: 58,792,314 (GRCm39) S50T probably benign Het
Col7a1 A G 9: 108,796,093 (GRCm39) K1553R unknown Het
Cxcr6 A C 9: 123,640,006 (GRCm39) T343P probably benign Het
Cyp11b2 T A 15: 74,727,914 (GRCm39) Q56L probably damaging Het
Dip2a A G 10: 76,114,320 (GRCm39) probably null Het
Dnmbp A G 19: 43,838,276 (GRCm39) V742A probably benign Het
Dusp16 A T 6: 134,716,732 (GRCm39) S192T probably benign Het
Ehbp1 A T 11: 22,182,053 (GRCm39) D87E probably damaging Het
Fgl1 A G 8: 41,652,748 (GRCm39) V150A probably benign Het
Flt3 T C 5: 147,271,673 (GRCm39) D873G probably damaging Het
Gart T C 16: 91,427,591 (GRCm39) D469G possibly damaging Het
Gm28168 T G 1: 117,875,625 (GRCm39) S85A probably benign Het
Golgb1 A G 16: 36,736,051 (GRCm39) D1807G probably benign Het
Grm8 A G 6: 27,761,351 (GRCm39) L291S probably damaging Het
Gucy2d C T 7: 98,092,676 (GRCm39) P18S possibly damaging Het
Ifna15 C T 4: 88,475,998 (GRCm39) C162Y probably damaging Het
Iqub C A 6: 24,479,307 (GRCm39) E412* probably null Het
Krt4 T A 15: 101,829,077 (GRCm39) D312V Het
Krtap26-1 T C 16: 88,444,324 (GRCm39) Y99C probably damaging Het
Krtap26-1 A T 16: 88,444,303 (GRCm39) I106N probably damaging Het
Lipn T C 19: 34,062,116 (GRCm39) I357T probably benign Het
Lrrc14b A G 13: 74,512,068 (GRCm39) L4P probably damaging Het
Mrgpra9 A T 7: 46,885,041 (GRCm39) C209S probably benign Het
Myo5a A G 9: 75,074,328 (GRCm39) T746A probably damaging Het
Myom2 A C 8: 15,164,169 (GRCm39) E1021D possibly damaging Het
Ncoa2 C T 1: 13,247,409 (GRCm39) R338H probably benign Het
Ncor2 A G 5: 125,195,821 (GRCm39) F91L Het
Neb C G 2: 52,106,923 (GRCm39) A4407P probably damaging Het
Or10u4 C T 10: 129,801,661 (GRCm39) V297M probably damaging Het
Or1j18 A T 2: 36,625,203 (GRCm39) Y290F probably damaging Het
Or4b1b A G 2: 90,126,356 (GRCm39) I283T probably damaging Het
Or5d47 A G 2: 87,804,347 (GRCm39) F221L probably benign Het
Or5p76 T G 7: 108,122,350 (GRCm39) Y269S probably benign Het
Or5w12 T C 2: 87,502,304 (GRCm39) M136V possibly damaging Het
Peg10 T TCCC 6: 4,756,451 (GRCm39) probably benign Het
Piwil4 C A 9: 14,638,771 (GRCm39) K298N probably benign Het
Prkcz G A 4: 155,429,285 (GRCm39) probably benign Het
Prkg2 G A 5: 99,090,067 (GRCm39) P691L possibly damaging Het
Ptprc T A 1: 138,041,446 (GRCm39) K89* probably null Het
Rapgef3 C T 15: 97,664,789 (GRCm39) A25T probably benign Het
Rreb1 C T 13: 38,114,492 (GRCm39) T617I probably damaging Het
Rsph1 A C 17: 31,492,350 (GRCm39) V72G possibly damaging Het
Shc2 A G 10: 79,473,536 (GRCm39) V50A probably benign Het
Slc38a9 G A 13: 112,838,021 (GRCm39) R262H probably benign Het
Slco6c1 T A 1: 97,055,884 (GRCm39) N6Y possibly damaging Het
Smarca5 A G 8: 81,431,961 (GRCm39) F886L probably benign Het
Tas1r2 A G 4: 139,381,074 (GRCm39) probably benign Het
Tnrc6c T A 11: 117,630,680 (GRCm39) probably benign Het
Trim30b T A 7: 104,007,113 (GRCm39) probably benign Het
Trim55 T C 3: 19,727,126 (GRCm39) S398P probably benign Het
Ttc39c T A 18: 12,820,003 (GRCm39) probably benign Het
Ubxn10 A G 4: 138,463,178 (GRCm39) probably null Het
Usf3 A G 16: 44,035,976 (GRCm39) N152S probably benign Het
Vps13b T A 15: 35,533,445 (GRCm39) V839E probably damaging Het
Zeb1 T A 18: 5,748,680 (GRCm39) probably benign Het
Zfp780b T C 7: 27,662,893 (GRCm39) Y554C probably benign Het
Zhx2 C T 15: 57,684,676 (GRCm39) T15I probably damaging Het
Other mutations in Myh7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Myh7b APN 2 155,472,212 (GRCm39) missense probably damaging 0.99
IGL01604:Myh7b APN 2 155,474,327 (GRCm39) missense probably damaging 0.96
IGL02179:Myh7b APN 2 155,456,411 (GRCm39) missense probably benign 0.02
IGL02729:Myh7b APN 2 155,467,609 (GRCm39) missense probably damaging 1.00
IGL02804:Myh7b APN 2 155,467,643 (GRCm39) missense probably damaging 1.00
IGL02851:Myh7b APN 2 155,470,747 (GRCm39) missense probably damaging 1.00
IGL02956:Myh7b APN 2 155,467,874 (GRCm39) missense possibly damaging 0.95
IGL02956:Myh7b APN 2 155,474,823 (GRCm39) missense probably damaging 1.00
IGL02992:Myh7b APN 2 155,463,330 (GRCm39) missense probably damaging 0.99
IGL03060:Myh7b APN 2 155,474,671 (GRCm39) missense probably damaging 1.00
IGL03061:Myh7b APN 2 155,462,031 (GRCm39) missense possibly damaging 0.93
IGL03226:Myh7b APN 2 155,462,403 (GRCm39) nonsense probably null
IGL03246:Myh7b APN 2 155,459,792 (GRCm39) missense probably damaging 1.00
IGL03382:Myh7b APN 2 155,465,399 (GRCm39) missense probably damaging 1.00
euclidian UTSW 2 155,475,319 (GRCm39) missense probably benign 0.32
imaginary UTSW 2 155,474,175 (GRCm39) missense probably benign 0.36
Irrational UTSW 2 155,472,592 (GRCm39) unclassified probably benign
Muscoli UTSW 2 155,462,038 (GRCm39) nonsense probably null
R0015:Myh7b UTSW 2 155,464,206 (GRCm39) missense probably damaging 1.00
R0015:Myh7b UTSW 2 155,464,206 (GRCm39) missense probably damaging 1.00
R0109:Myh7b UTSW 2 155,453,594 (GRCm39) missense possibly damaging 0.92
R0309:Myh7b UTSW 2 155,472,592 (GRCm39) unclassified probably benign
R0567:Myh7b UTSW 2 155,468,318 (GRCm39) missense probably damaging 1.00
R0619:Myh7b UTSW 2 155,453,642 (GRCm39) missense probably benign 0.00
R0927:Myh7b UTSW 2 155,462,040 (GRCm39) missense probably damaging 1.00
R0973:Myh7b UTSW 2 155,462,347 (GRCm39) missense probably benign
R0973:Myh7b UTSW 2 155,462,347 (GRCm39) missense probably benign
R0974:Myh7b UTSW 2 155,462,347 (GRCm39) missense probably benign
R1137:Myh7b UTSW 2 155,464,634 (GRCm39) missense probably damaging 1.00
R1261:Myh7b UTSW 2 155,463,003 (GRCm39) missense probably benign 0.00
R1268:Myh7b UTSW 2 155,455,966 (GRCm39) nonsense probably null
R1537:Myh7b UTSW 2 155,473,707 (GRCm39) missense probably damaging 0.96
R1632:Myh7b UTSW 2 155,462,445 (GRCm39) missense probably benign 0.04
R1694:Myh7b UTSW 2 155,455,113 (GRCm39) missense probably damaging 0.99
R1697:Myh7b UTSW 2 155,462,054 (GRCm39) missense probably damaging 1.00
R1730:Myh7b UTSW 2 155,467,592 (GRCm39) missense possibly damaging 0.73
R1762:Myh7b UTSW 2 155,472,778 (GRCm39) missense probably damaging 0.96
R1783:Myh7b UTSW 2 155,467,592 (GRCm39) missense possibly damaging 0.73
R2105:Myh7b UTSW 2 155,471,377 (GRCm39) missense probably benign 0.00
R2140:Myh7b UTSW 2 155,462,043 (GRCm39) missense probably damaging 1.00
R2971:Myh7b UTSW 2 155,474,175 (GRCm39) missense probably benign 0.36
R3838:Myh7b UTSW 2 155,474,909 (GRCm39) missense probably damaging 1.00
R4074:Myh7b UTSW 2 155,460,678 (GRCm39) missense probably damaging 0.96
R4191:Myh7b UTSW 2 155,475,319 (GRCm39) missense probably benign 0.32
R4689:Myh7b UTSW 2 155,472,434 (GRCm39) missense possibly damaging 0.75
R4695:Myh7b UTSW 2 155,456,097 (GRCm39) missense probably damaging 1.00
R4697:Myh7b UTSW 2 155,471,242 (GRCm39) missense probably damaging 1.00
R4771:Myh7b UTSW 2 155,468,314 (GRCm39) nonsense probably null
R4794:Myh7b UTSW 2 155,465,186 (GRCm39) missense probably benign 0.00
R4842:Myh7b UTSW 2 155,475,909 (GRCm39) missense probably benign 0.45
R4871:Myh7b UTSW 2 155,455,420 (GRCm39) missense probably benign 0.18
R5022:Myh7b UTSW 2 155,474,293 (GRCm39) missense possibly damaging 0.75
R5023:Myh7b UTSW 2 155,474,293 (GRCm39) missense possibly damaging 0.75
R5025:Myh7b UTSW 2 155,474,293 (GRCm39) missense possibly damaging 0.75
R5050:Myh7b UTSW 2 155,473,670 (GRCm39) missense probably benign 0.00
R5055:Myh7b UTSW 2 155,474,293 (GRCm39) missense possibly damaging 0.75
R5056:Myh7b UTSW 2 155,474,293 (GRCm39) missense possibly damaging 0.75
R5161:Myh7b UTSW 2 155,474,293 (GRCm39) missense possibly damaging 0.75
R5284:Myh7b UTSW 2 155,474,234 (GRCm39) missense probably benign
R5422:Myh7b UTSW 2 155,472,954 (GRCm39) missense probably damaging 0.99
R5505:Myh7b UTSW 2 155,474,592 (GRCm39) missense probably benign 0.01
R5946:Myh7b UTSW 2 155,463,315 (GRCm39) missense probably damaging 1.00
R6089:Myh7b UTSW 2 155,464,409 (GRCm39) missense probably damaging 1.00
R6103:Myh7b UTSW 2 155,460,663 (GRCm39) missense probably damaging 1.00
R6233:Myh7b UTSW 2 155,473,719 (GRCm39) missense possibly damaging 0.85
R6292:Myh7b UTSW 2 155,474,316 (GRCm39) missense probably damaging 1.00
R6350:Myh7b UTSW 2 155,470,680 (GRCm39) missense probably benign 0.00
R6484:Myh7b UTSW 2 155,470,563 (GRCm39) missense probably benign 0.05
R6760:Myh7b UTSW 2 155,462,038 (GRCm39) nonsense probably null
R6896:Myh7b UTSW 2 155,464,488 (GRCm39) critical splice donor site probably null
R6945:Myh7b UTSW 2 155,464,152 (GRCm39) missense possibly damaging 0.95
R7020:Myh7b UTSW 2 155,473,671 (GRCm39) missense possibly damaging 0.56
R7052:Myh7b UTSW 2 155,456,053 (GRCm39) missense probably damaging 1.00
R7102:Myh7b UTSW 2 155,464,119 (GRCm39) missense probably damaging 1.00
R7248:Myh7b UTSW 2 155,464,106 (GRCm39) missense probably damaging 1.00
R7303:Myh7b UTSW 2 155,460,660 (GRCm39) missense probably damaging 1.00
R7360:Myh7b UTSW 2 155,474,460 (GRCm39) missense probably benign 0.38
R7652:Myh7b UTSW 2 155,474,156 (GRCm39) missense probably damaging 0.99
R7678:Myh7b UTSW 2 155,459,698 (GRCm39) splice site probably null
R7703:Myh7b UTSW 2 155,462,356 (GRCm39) missense probably null 1.00
R7711:Myh7b UTSW 2 155,462,323 (GRCm39) missense probably damaging 1.00
R7923:Myh7b UTSW 2 155,467,886 (GRCm39) missense probably benign
R7967:Myh7b UTSW 2 155,456,119 (GRCm39) splice site probably null
R8045:Myh7b UTSW 2 155,455,101 (GRCm39) missense probably benign 0.00
R8176:Myh7b UTSW 2 155,467,886 (GRCm39) missense probably benign 0.06
R8272:Myh7b UTSW 2 155,474,824 (GRCm39) missense probably damaging 1.00
R8560:Myh7b UTSW 2 155,465,124 (GRCm39) missense possibly damaging 0.93
R8706:Myh7b UTSW 2 155,453,669 (GRCm39) critical splice donor site probably null
R8832:Myh7b UTSW 2 155,475,182 (GRCm39) missense probably benign 0.00
R9079:Myh7b UTSW 2 155,465,174 (GRCm39) missense probably damaging 0.97
R9151:Myh7b UTSW 2 155,474,439 (GRCm39) missense probably damaging 1.00
R9311:Myh7b UTSW 2 155,463,253 (GRCm39) missense probably damaging 1.00
R9332:Myh7b UTSW 2 155,470,722 (GRCm39) missense probably damaging 1.00
R9357:Myh7b UTSW 2 155,463,268 (GRCm39) missense probably damaging 1.00
R9388:Myh7b UTSW 2 155,472,983 (GRCm39) missense probably benign 0.28
R9583:Myh7b UTSW 2 155,459,641 (GRCm39) missense probably damaging 1.00
R9657:Myh7b UTSW 2 155,455,963 (GRCm39) missense probably damaging 1.00
R9738:Myh7b UTSW 2 155,455,963 (GRCm39) missense probably damaging 1.00
X0013:Myh7b UTSW 2 155,473,089 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTGTTCTAGGTCCCAGTCCC -3'
(R):5'- GAAGTTCCTCCAGACTCTGC -3'

Sequencing Primer
(F):5'- AGTCTCTTGCCTGGCAGC -3'
(R):5'- CTGCGCTGCTGAGGTCTTC -3'
Posted On 2021-07-15