Incidental Mutation 'R8824:Trim55'
ID673312
Institutional Source Beutler Lab
Gene Symbol Trim55
Ensembl Gene ENSMUSG00000060913
Gene Nametripartite motif-containing 55
SynonymsD830041C10Rik, Murf2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8824 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location19644474-19692421 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19672962 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 398 (S398P)
Ref Sequence ENSEMBL: ENSMUSP00000029139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029139]
Predicted Effect probably benign
Transcript: ENSMUST00000029139
AA Change: S398P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029139
Gene: ENSMUSG00000060913
AA Change: S398P

DomainStartEndE-ValueType
RING 26 81 3.69e-8 SMART
BBOX 119 161 3.58e-6 SMART
Blast:BBC 168 294 2e-33 BLAST
PDB:4M3L|D 215 272 2e-12 PDB
low complexity region 329 355 N/A INTRINSIC
low complexity region 384 398 N/A INTRINSIC
low complexity region 474 485 N/A INTRINSIC
low complexity region 514 526 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING zinc finger, a motif known to be involved in protein-protein interactions. This protein associates transiently with microtubules, myosin, and titin during muscle sarcomere assembly. It may act as a transient adaptor and plays a regulatory role in the assembly of sarcomeres. Four alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased heart and muscle to body weight ratios and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl A T 2: 93,862,850 V260D probably damaging Het
Adora2a G A 10: 75,326,179 A51T probably damaging Het
Afg1l G A 10: 42,438,387 P128S possibly damaging Het
Ago4 C A 4: 126,507,184 V623L probably benign Het
Akap11 A T 14: 78,516,347 N112K Het
C1ra A T 6: 124,517,695 I306F probably damaging Het
Ccdc73 A G 2: 104,991,877 N724D possibly damaging Het
Cd248 A G 19: 5,069,617 I498V probably benign Het
Clrn1 A T 3: 58,884,893 S50T probably benign Het
Col7a1 A G 9: 108,967,025 K1553R unknown Het
Cxcr6 A C 9: 123,810,941 T343P probably benign Het
Cyp11b2 T A 15: 74,856,065 Q56L probably damaging Het
Dip2a A G 10: 76,278,486 probably null Het
Dnmbp A G 19: 43,849,837 V742A probably benign Het
Dusp16 A T 6: 134,739,769 S192T probably benign Het
Ehbp1 A T 11: 22,232,053 D87E probably damaging Het
Fgl1 A G 8: 41,199,711 V150A probably benign Het
Flt3 T C 5: 147,334,863 D873G probably damaging Het
Gart T C 16: 91,630,703 D469G possibly damaging Het
Gm28168 T G 1: 117,947,895 S85A probably benign Het
Golgb1 A G 16: 36,915,689 D1807G probably benign Het
Grm8 A G 6: 27,761,352 L291S probably damaging Het
Gucy2d C T 7: 98,443,469 P18S possibly damaging Het
Ifna15 C T 4: 88,557,761 C162Y probably damaging Het
Iqub C A 6: 24,479,308 E412* probably null Het
Krt4 T A 15: 101,920,642 D312V Het
Krtap26-1 A T 16: 88,647,415 I106N probably damaging Het
Krtap26-1 T C 16: 88,647,436 Y99C probably damaging Het
Lipn T C 19: 34,084,716 I357T probably benign Het
Lrrc14b A G 13: 74,363,949 L4P probably damaging Het
Mrgpra9 A T 7: 47,235,293 C209S probably benign Het
Myh7b A G 2: 155,630,381 N1291D probably benign Het
Myo5a A G 9: 75,167,046 T746A probably damaging Het
Myom2 A C 8: 15,114,169 E1021D possibly damaging Het
Ncoa2 C T 1: 13,177,185 R338H probably benign Het
Ncor2 A G 5: 125,118,757 F91L Het
Neb C G 2: 52,216,911 A4407P probably damaging Het
Olfr1135 T C 2: 87,671,960 M136V possibly damaging Het
Olfr347 A T 2: 36,735,191 Y290F probably damaging Het
Olfr502 T G 7: 108,523,143 Y269S probably benign Het
Olfr74 A G 2: 87,974,003 F221L probably benign Het
Olfr819 C T 10: 129,965,792 V297M probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Piwil4 C A 9: 14,727,475 K298N probably benign Het
Prkcz G A 4: 155,344,828 probably benign Het
Prkg2 G A 5: 98,942,208 P691L possibly damaging Het
Ptprc T A 1: 138,113,708 K89* probably null Het
Rapgef3 C T 15: 97,766,908 A25T probably benign Het
Rreb1 C T 13: 37,930,516 T617I probably damaging Het
Rsph1 A C 17: 31,273,376 V72G possibly damaging Het
Shc2 A G 10: 79,637,702 V50A probably benign Het
Slc38a9 G A 13: 112,701,487 R262H probably benign Het
Slco6c1 T A 1: 97,128,159 N6Y possibly damaging Het
Smarca5 A G 8: 80,705,332 F886L probably benign Het
Trim30b T A 7: 104,357,906 probably benign Het
Ubxn10 A G 4: 138,735,867 probably null Het
Usf3 A G 16: 44,215,613 N152S probably benign Het
Vps13b T A 15: 35,533,299 V839E probably damaging Het
Zfp780b T C 7: 27,963,468 Y554C probably benign Het
Zhx2 C T 15: 57,821,280 T15I probably damaging Het
Other mutations in Trim55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02948:Trim55 APN 3 19670952 missense probably damaging 1.00
IGL03095:Trim55 APN 3 19674465 missense probably benign 0.00
IGL03411:Trim55 APN 3 19659190 missense probably damaging 0.99
R0011:Trim55 UTSW 3 19670999 missense probably benign 0.00
R0021:Trim55 UTSW 3 19644702 missense probably benign 0.04
R0021:Trim55 UTSW 3 19644702 missense probably benign 0.04
R0194:Trim55 UTSW 3 19661861 missense probably benign 0.00
R0437:Trim55 UTSW 3 19670978 missense probably benign
R0450:Trim55 UTSW 3 19671092 missense possibly damaging 0.55
R0469:Trim55 UTSW 3 19671092 missense possibly damaging 0.55
R1029:Trim55 UTSW 3 19644742 missense probably damaging 1.00
R1397:Trim55 UTSW 3 19644637 missense probably benign 0.01
R1928:Trim55 UTSW 3 19661882 critical splice donor site probably null
R2079:Trim55 UTSW 3 19644666 missense probably damaging 0.98
R3856:Trim55 UTSW 3 19672956 missense probably benign
R4646:Trim55 UTSW 3 19671122 missense probably benign 0.03
R4907:Trim55 UTSW 3 19674374 missense probably benign
R5090:Trim55 UTSW 3 19671607 missense probably benign 0.08
R5562:Trim55 UTSW 3 19659153 missense probably benign 0.04
R6370:Trim55 UTSW 3 19691486 missense possibly damaging 0.87
R6658:Trim55 UTSW 3 19691555 missense probably damaging 1.00
R6786:Trim55 UTSW 3 19672774 missense probably benign
R8147:Trim55 UTSW 3 19672847 missense probably benign 0.28
R8524:Trim55 UTSW 3 19670949 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGTTTCTATGGCTACCATGG -3'
(R):5'- TCTGGCATTGTAACTGTCCTGATC -3'

Sequencing Primer
(F):5'- TTTCTATGGCTACCATGGTAGTAG -3'
(R):5'- GCATTGTAACTGTCCTGATCTCCTC -3'
Posted On2021-07-15