Incidental Mutation 'R8824:Clrn1'
ID 673313
Institutional Source Beutler Lab
Gene Symbol Clrn1
Ensembl Gene ENSMUSG00000043850
Gene Name clarin 1
Synonyms clarin-1, USH3, Ush3a, A130002D11Rik
MMRRC Submission 068657-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8824 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 58751449-58792633 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 58792314 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 50 (S50T)
Ref Sequence ENSEMBL: ENSMUSP00000052254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051408] [ENSMUST00000055636] [ENSMUST00000072551]
AlphaFold Q8K445
Predicted Effect probably benign
Transcript: ENSMUST00000051408
AA Change: S50T

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000051738
Gene: ENSMUSG00000043850
AA Change: S50T

DomainStartEndE-ValueType
Pfam:Claudin_2 18 208 1.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000055636
AA Change: S50T

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000052254
Gene: ENSMUSG00000043850
AA Change: S50T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
transmembrane domain 207 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072551
AA Change: S50T

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000072363
Gene: ENSMUSG00000043850
AA Change: S50T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SCOP:d1hw7a_ 65 87 5e-3 SMART
transmembrane domain 129 151 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a cytosolic N-terminus, multiple helical transmembrane domains, and an endoplasmic reticulum membrane retention signal, TKGH, in the C-terminus. The encoded protein may be important in development and homeostasis of the inner ear and retina. Mutations within this gene have been associated with Usher syndrome type IIIa. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss and loss of balance associated with defects in outer hair cells and supporting cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl A T 2: 93,693,195 (GRCm39) V260D probably damaging Het
Adora2a G A 10: 75,162,013 (GRCm39) A51T probably damaging Het
Afg1l G A 10: 42,314,383 (GRCm39) P128S possibly damaging Het
Ago4 C A 4: 126,400,977 (GRCm39) V623L probably benign Het
Akap11 A T 14: 78,753,787 (GRCm39) N112K Het
C1ra A T 6: 124,494,654 (GRCm39) I306F probably damaging Het
Ccdc73 A G 2: 104,822,222 (GRCm39) N724D possibly damaging Het
Cd248 A G 19: 5,119,645 (GRCm39) I498V probably benign Het
Col7a1 A G 9: 108,796,093 (GRCm39) K1553R unknown Het
Cxcr6 A C 9: 123,640,006 (GRCm39) T343P probably benign Het
Cyp11b2 T A 15: 74,727,914 (GRCm39) Q56L probably damaging Het
Dip2a A G 10: 76,114,320 (GRCm39) probably null Het
Dnmbp A G 19: 43,838,276 (GRCm39) V742A probably benign Het
Dusp16 A T 6: 134,716,732 (GRCm39) S192T probably benign Het
Ehbp1 A T 11: 22,182,053 (GRCm39) D87E probably damaging Het
Fgl1 A G 8: 41,652,748 (GRCm39) V150A probably benign Het
Flt3 T C 5: 147,271,673 (GRCm39) D873G probably damaging Het
Gart T C 16: 91,427,591 (GRCm39) D469G possibly damaging Het
Gm28168 T G 1: 117,875,625 (GRCm39) S85A probably benign Het
Golgb1 A G 16: 36,736,051 (GRCm39) D1807G probably benign Het
Grm8 A G 6: 27,761,351 (GRCm39) L291S probably damaging Het
Gucy2d C T 7: 98,092,676 (GRCm39) P18S possibly damaging Het
Ifna15 C T 4: 88,475,998 (GRCm39) C162Y probably damaging Het
Iqub C A 6: 24,479,307 (GRCm39) E412* probably null Het
Krt4 T A 15: 101,829,077 (GRCm39) D312V Het
Krtap26-1 T C 16: 88,444,324 (GRCm39) Y99C probably damaging Het
Krtap26-1 A T 16: 88,444,303 (GRCm39) I106N probably damaging Het
Lipn T C 19: 34,062,116 (GRCm39) I357T probably benign Het
Lrrc14b A G 13: 74,512,068 (GRCm39) L4P probably damaging Het
Mrgpra9 A T 7: 46,885,041 (GRCm39) C209S probably benign Het
Myh7b A G 2: 155,472,301 (GRCm39) N1291D probably benign Het
Myo5a A G 9: 75,074,328 (GRCm39) T746A probably damaging Het
Myom2 A C 8: 15,164,169 (GRCm39) E1021D possibly damaging Het
Ncoa2 C T 1: 13,247,409 (GRCm39) R338H probably benign Het
Ncor2 A G 5: 125,195,821 (GRCm39) F91L Het
Neb C G 2: 52,106,923 (GRCm39) A4407P probably damaging Het
Or10u4 C T 10: 129,801,661 (GRCm39) V297M probably damaging Het
Or1j18 A T 2: 36,625,203 (GRCm39) Y290F probably damaging Het
Or4b1b A G 2: 90,126,356 (GRCm39) I283T probably damaging Het
Or5d47 A G 2: 87,804,347 (GRCm39) F221L probably benign Het
Or5p76 T G 7: 108,122,350 (GRCm39) Y269S probably benign Het
Or5w12 T C 2: 87,502,304 (GRCm39) M136V possibly damaging Het
Peg10 T TCCC 6: 4,756,451 (GRCm39) probably benign Het
Piwil4 C A 9: 14,638,771 (GRCm39) K298N probably benign Het
Prkcz G A 4: 155,429,285 (GRCm39) probably benign Het
Prkg2 G A 5: 99,090,067 (GRCm39) P691L possibly damaging Het
Ptprc T A 1: 138,041,446 (GRCm39) K89* probably null Het
Rapgef3 C T 15: 97,664,789 (GRCm39) A25T probably benign Het
Rreb1 C T 13: 38,114,492 (GRCm39) T617I probably damaging Het
Rsph1 A C 17: 31,492,350 (GRCm39) V72G possibly damaging Het
Shc2 A G 10: 79,473,536 (GRCm39) V50A probably benign Het
Slc38a9 G A 13: 112,838,021 (GRCm39) R262H probably benign Het
Slco6c1 T A 1: 97,055,884 (GRCm39) N6Y possibly damaging Het
Smarca5 A G 8: 81,431,961 (GRCm39) F886L probably benign Het
Tas1r2 A G 4: 139,381,074 (GRCm39) probably benign Het
Tnrc6c T A 11: 117,630,680 (GRCm39) probably benign Het
Trim30b T A 7: 104,007,113 (GRCm39) probably benign Het
Trim55 T C 3: 19,727,126 (GRCm39) S398P probably benign Het
Ttc39c T A 18: 12,820,003 (GRCm39) probably benign Het
Ubxn10 A G 4: 138,463,178 (GRCm39) probably null Het
Usf3 A G 16: 44,035,976 (GRCm39) N152S probably benign Het
Vps13b T A 15: 35,533,445 (GRCm39) V839E probably damaging Het
Zeb1 T A 18: 5,748,680 (GRCm39) probably benign Het
Zfp780b T C 7: 27,662,893 (GRCm39) Y554C probably benign Het
Zhx2 C T 15: 57,684,676 (GRCm39) T15I probably damaging Het
Other mutations in Clrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Clrn1 APN 3 58,792,446 (GRCm39) missense probably damaging 0.99
IGL03184:Clrn1 APN 3 58,753,645 (GRCm39) missense probably benign 0.00
IGL03187:Clrn1 APN 3 58,753,854 (GRCm39) missense probably damaging 0.99
R0015:Clrn1 UTSW 3 58,753,848 (GRCm39) missense probably damaging 0.99
R0015:Clrn1 UTSW 3 58,753,848 (GRCm39) missense probably damaging 0.99
R1055:Clrn1 UTSW 3 58,772,531 (GRCm39) missense probably benign 0.38
R2301:Clrn1 UTSW 3 58,753,773 (GRCm39) missense probably damaging 1.00
R4753:Clrn1 UTSW 3 58,792,318 (GRCm39) missense probably damaging 1.00
R5493:Clrn1 UTSW 3 58,753,837 (GRCm39) missense probably damaging 1.00
R5916:Clrn1 UTSW 3 58,753,783 (GRCm39) missense probably benign 0.13
R6393:Clrn1 UTSW 3 58,753,741 (GRCm39) missense probably damaging 1.00
R6719:Clrn1 UTSW 3 58,753,861 (GRCm39) missense probably damaging 0.99
R7722:Clrn1 UTSW 3 58,753,755 (GRCm39) missense possibly damaging 0.52
R9342:Clrn1 UTSW 3 58,792,251 (GRCm39) missense probably benign 0.01
R9681:Clrn1 UTSW 3 58,792,251 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACAGGGCAAGATCCTCTTTATGTC -3'
(R):5'- CGCTACTTGATGCTCACAAAGG -3'

Sequencing Primer
(F):5'- ATGTCTTTGCAACAGCTGGAAG -3'
(R):5'- TTCAAGTTTGTCTTTACCGAAGC -3'
Posted On 2021-07-15