Incidental Mutation 'R8824:Ifna15'
ID 673314
Institutional Source Beutler Lab
Gene Symbol Ifna15
Ensembl Gene ENSMUSG00000096011
Gene Name interferon alpha 15
Synonyms Ifnaa, Gm12597
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R8824 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 88557673-88558245 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 88557761 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 162 (C162Y)
Ref Sequence ENSEMBL: ENSMUSP00000099873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102809]
AlphaFold Q61718
Predicted Effect probably damaging
Transcript: ENSMUST00000102809
AA Change: C162Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099873
Gene: ENSMUSG00000096011
AA Change: C162Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IFabd 58 175 2.97e-68 SMART
Meta Mutation Damage Score 0.8967 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl A T 2: 93,862,850 V260D probably damaging Het
Adora2a G A 10: 75,326,179 A51T probably damaging Het
Afg1l G A 10: 42,438,387 P128S possibly damaging Het
Ago4 C A 4: 126,507,184 V623L probably benign Het
Akap11 A T 14: 78,516,347 N112K Het
C1ra A T 6: 124,517,695 I306F probably damaging Het
Ccdc73 A G 2: 104,991,877 N724D possibly damaging Het
Cd248 A G 19: 5,069,617 I498V probably benign Het
Clrn1 A T 3: 58,884,893 S50T probably benign Het
Col7a1 A G 9: 108,967,025 K1553R unknown Het
Cxcr6 A C 9: 123,810,941 T343P probably benign Het
Cyp11b2 T A 15: 74,856,065 Q56L probably damaging Het
Dip2a A G 10: 76,278,486 probably null Het
Dnmbp A G 19: 43,849,837 V742A probably benign Het
Dusp16 A T 6: 134,739,769 S192T probably benign Het
Ehbp1 A T 11: 22,232,053 D87E probably damaging Het
Fgl1 A G 8: 41,199,711 V150A probably benign Het
Flt3 T C 5: 147,334,863 D873G probably damaging Het
Gart T C 16: 91,630,703 D469G possibly damaging Het
Gm28168 T G 1: 117,947,895 S85A probably benign Het
Golgb1 A G 16: 36,915,689 D1807G probably benign Het
Grm8 A G 6: 27,761,352 L291S probably damaging Het
Gucy2d C T 7: 98,443,469 P18S possibly damaging Het
Iqub C A 6: 24,479,308 E412* probably null Het
Krt4 T A 15: 101,920,642 D312V Het
Krtap26-1 A T 16: 88,647,415 I106N probably damaging Het
Krtap26-1 T C 16: 88,647,436 Y99C probably damaging Het
Lipn T C 19: 34,084,716 I357T probably benign Het
Lrrc14b A G 13: 74,363,949 L4P probably damaging Het
Mrgpra9 A T 7: 47,235,293 C209S probably benign Het
Myh7b A G 2: 155,630,381 N1291D probably benign Het
Myo5a A G 9: 75,167,046 T746A probably damaging Het
Myom2 A C 8: 15,114,169 E1021D possibly damaging Het
Ncoa2 C T 1: 13,177,185 R338H probably benign Het
Ncor2 A G 5: 125,118,757 F91L Het
Neb C G 2: 52,216,911 A4407P probably damaging Het
Olfr1135 T C 2: 87,671,960 M136V possibly damaging Het
Olfr1272 A G 2: 90,296,012 I283T probably damaging Het
Olfr347 A T 2: 36,735,191 Y290F probably damaging Het
Olfr502 T G 7: 108,523,143 Y269S probably benign Het
Olfr74 A G 2: 87,974,003 F221L probably benign Het
Olfr819 C T 10: 129,965,792 V297M probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Piwil4 C A 9: 14,727,475 K298N probably benign Het
Prkcz G A 4: 155,344,828 probably benign Het
Prkg2 G A 5: 98,942,208 P691L possibly damaging Het
Ptprc T A 1: 138,113,708 K89* probably null Het
Rapgef3 C T 15: 97,766,908 A25T probably benign Het
Rreb1 C T 13: 37,930,516 T617I probably damaging Het
Rsph1 A C 17: 31,273,376 V72G possibly damaging Het
Shc2 A G 10: 79,637,702 V50A probably benign Het
Slc38a9 G A 13: 112,701,487 R262H probably benign Het
Slco6c1 T A 1: 97,128,159 N6Y possibly damaging Het
Smarca5 A G 8: 80,705,332 F886L probably benign Het
Tas1r2 A G 4: 139,653,763 probably benign Het
Tnrc6c T A 11: 117,739,854 probably benign Het
Trim30b T A 7: 104,357,906 probably benign Het
Trim55 T C 3: 19,672,962 S398P probably benign Het
Ttc39c T A 18: 12,686,946 probably benign Het
Ubxn10 A G 4: 138,735,867 probably null Het
Usf3 A G 16: 44,215,613 N152S probably benign Het
Vps13b T A 15: 35,533,299 V839E probably damaging Het
Zeb1 T A 18: 5,748,680 probably benign Het
Zfp780b T C 7: 27,963,468 Y554C probably benign Het
Zhx2 C T 15: 57,821,280 T15I probably damaging Het
Other mutations in Ifna15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01575:Ifna15 APN 4 88557807 missense probably damaging 1.00
IGL01757:Ifna15 APN 4 88558085 missense possibly damaging 0.79
IGL01824:Ifna15 APN 4 88557783 missense probably benign 0.00
R3853:Ifna15 UTSW 4 88557809 missense probably damaging 1.00
R4356:Ifna15 UTSW 4 88557842 missense probably benign 0.09
R4357:Ifna15 UTSW 4 88557842 missense probably benign 0.09
R4358:Ifna15 UTSW 4 88557842 missense probably benign 0.09
R4359:Ifna15 UTSW 4 88557842 missense probably benign 0.09
R5038:Ifna15 UTSW 4 88558029 missense probably benign 0.03
R5372:Ifna15 UTSW 4 88558101 missense probably damaging 0.97
R6036:Ifna15 UTSW 4 88558073 missense possibly damaging 0.65
R6036:Ifna15 UTSW 4 88558073 missense possibly damaging 0.65
R7347:Ifna15 UTSW 4 88557983 missense probably damaging 1.00
R8097:Ifna15 UTSW 4 88557701 missense probably benign 0.01
R8132:Ifna15 UTSW 4 88557683 missense possibly damaging 0.60
R9349:Ifna15 UTSW 4 88558046 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GAACATCTAGGCTGGTTGATTG -3'
(R):5'- CTCATCTGCTGCTTGGGATG -3'

Sequencing Primer
(F):5'- AACATCTAGGCTGGTTGATTGTATTC -3'
(R):5'- CTGCTGCTTGGGATGCATCC -3'
Posted On 2021-07-15