Incidental Mutation 'R8824:Ubxn10'
ID 673316
Institutional Source Beutler Lab
Gene Symbol Ubxn10
Ensembl Gene ENSMUSG00000043621
Gene Name UBX domain protein 10
Synonyms Ubxd3, 5730509E04Rik
MMRRC Submission 068657-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R8824 (G1)
Quality Score 146.008
Status Validated
Chromosome 4
Chromosomal Location 138437148-138464478 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 138463178 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030530] [ENSMUST00000105808] [ENSMUST00000105810] [ENSMUST00000105810] [ENSMUST00000124660]
AlphaFold Q8BG34
Predicted Effect probably benign
Transcript: ENSMUST00000030530
SMART Domains Protein: ENSMUSP00000030530
Gene: ENSMUSG00000028750

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PA2c 21 143 1.83e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105808
SMART Domains Protein: ENSMUSP00000101434
Gene: ENSMUSG00000028750

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PA2c 21 143 1.83e-50 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105810
SMART Domains Protein: ENSMUSP00000101436
Gene: ENSMUSG00000043621

DomainStartEndE-ValueType
low complexity region 60 77 N/A INTRINSIC
UBX 188 270 5.36e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105810
SMART Domains Protein: ENSMUSP00000101436
Gene: ENSMUSG00000043621

DomainStartEndE-ValueType
low complexity region 60 77 N/A INTRINSIC
UBX 188 270 5.36e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124660
SMART Domains Protein: ENSMUSP00000124341
Gene: ENSMUSG00000028750

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PA2c 21 128 1.4e-37 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl A T 2: 93,693,195 (GRCm39) V260D probably damaging Het
Adora2a G A 10: 75,162,013 (GRCm39) A51T probably damaging Het
Afg1l G A 10: 42,314,383 (GRCm39) P128S possibly damaging Het
Ago4 C A 4: 126,400,977 (GRCm39) V623L probably benign Het
Akap11 A T 14: 78,753,787 (GRCm39) N112K Het
C1ra A T 6: 124,494,654 (GRCm39) I306F probably damaging Het
Ccdc73 A G 2: 104,822,222 (GRCm39) N724D possibly damaging Het
Cd248 A G 19: 5,119,645 (GRCm39) I498V probably benign Het
Clrn1 A T 3: 58,792,314 (GRCm39) S50T probably benign Het
Col7a1 A G 9: 108,796,093 (GRCm39) K1553R unknown Het
Cxcr6 A C 9: 123,640,006 (GRCm39) T343P probably benign Het
Cyp11b2 T A 15: 74,727,914 (GRCm39) Q56L probably damaging Het
Dip2a A G 10: 76,114,320 (GRCm39) probably null Het
Dnmbp A G 19: 43,838,276 (GRCm39) V742A probably benign Het
Dusp16 A T 6: 134,716,732 (GRCm39) S192T probably benign Het
Ehbp1 A T 11: 22,182,053 (GRCm39) D87E probably damaging Het
Fgl1 A G 8: 41,652,748 (GRCm39) V150A probably benign Het
Flt3 T C 5: 147,271,673 (GRCm39) D873G probably damaging Het
Gart T C 16: 91,427,591 (GRCm39) D469G possibly damaging Het
Gm28168 T G 1: 117,875,625 (GRCm39) S85A probably benign Het
Golgb1 A G 16: 36,736,051 (GRCm39) D1807G probably benign Het
Grm8 A G 6: 27,761,351 (GRCm39) L291S probably damaging Het
Gucy2d C T 7: 98,092,676 (GRCm39) P18S possibly damaging Het
Ifna15 C T 4: 88,475,998 (GRCm39) C162Y probably damaging Het
Iqub C A 6: 24,479,307 (GRCm39) E412* probably null Het
Krt4 T A 15: 101,829,077 (GRCm39) D312V Het
Krtap26-1 T C 16: 88,444,324 (GRCm39) Y99C probably damaging Het
Krtap26-1 A T 16: 88,444,303 (GRCm39) I106N probably damaging Het
Lipn T C 19: 34,062,116 (GRCm39) I357T probably benign Het
Lrrc14b A G 13: 74,512,068 (GRCm39) L4P probably damaging Het
Mrgpra9 A T 7: 46,885,041 (GRCm39) C209S probably benign Het
Myh7b A G 2: 155,472,301 (GRCm39) N1291D probably benign Het
Myo5a A G 9: 75,074,328 (GRCm39) T746A probably damaging Het
Myom2 A C 8: 15,164,169 (GRCm39) E1021D possibly damaging Het
Ncoa2 C T 1: 13,247,409 (GRCm39) R338H probably benign Het
Ncor2 A G 5: 125,195,821 (GRCm39) F91L Het
Neb C G 2: 52,106,923 (GRCm39) A4407P probably damaging Het
Or10u4 C T 10: 129,801,661 (GRCm39) V297M probably damaging Het
Or1j18 A T 2: 36,625,203 (GRCm39) Y290F probably damaging Het
Or4b1b A G 2: 90,126,356 (GRCm39) I283T probably damaging Het
Or5d47 A G 2: 87,804,347 (GRCm39) F221L probably benign Het
Or5p76 T G 7: 108,122,350 (GRCm39) Y269S probably benign Het
Or5w12 T C 2: 87,502,304 (GRCm39) M136V possibly damaging Het
Peg10 T TCCC 6: 4,756,451 (GRCm39) probably benign Het
Piwil4 C A 9: 14,638,771 (GRCm39) K298N probably benign Het
Prkcz G A 4: 155,429,285 (GRCm39) probably benign Het
Prkg2 G A 5: 99,090,067 (GRCm39) P691L possibly damaging Het
Ptprc T A 1: 138,041,446 (GRCm39) K89* probably null Het
Rapgef3 C T 15: 97,664,789 (GRCm39) A25T probably benign Het
Rreb1 C T 13: 38,114,492 (GRCm39) T617I probably damaging Het
Rsph1 A C 17: 31,492,350 (GRCm39) V72G possibly damaging Het
Shc2 A G 10: 79,473,536 (GRCm39) V50A probably benign Het
Slc38a9 G A 13: 112,838,021 (GRCm39) R262H probably benign Het
Slco6c1 T A 1: 97,055,884 (GRCm39) N6Y possibly damaging Het
Smarca5 A G 8: 81,431,961 (GRCm39) F886L probably benign Het
Tas1r2 A G 4: 139,381,074 (GRCm39) probably benign Het
Tnrc6c T A 11: 117,630,680 (GRCm39) probably benign Het
Trim30b T A 7: 104,007,113 (GRCm39) probably benign Het
Trim55 T C 3: 19,727,126 (GRCm39) S398P probably benign Het
Ttc39c T A 18: 12,820,003 (GRCm39) probably benign Het
Usf3 A G 16: 44,035,976 (GRCm39) N152S probably benign Het
Vps13b T A 15: 35,533,445 (GRCm39) V839E probably damaging Het
Zeb1 T A 18: 5,748,680 (GRCm39) probably benign Het
Zfp780b T C 7: 27,662,893 (GRCm39) Y554C probably benign Het
Zhx2 C T 15: 57,684,676 (GRCm39) T15I probably damaging Het
Other mutations in Ubxn10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02149:Ubxn10 APN 4 138,448,584 (GRCm39) missense probably benign 0.00
IGL03216:Ubxn10 APN 4 138,448,050 (GRCm39) missense probably damaging 1.00
PIT1430001:Ubxn10 UTSW 4 138,448,199 (GRCm39) missense probably benign 0.01
R0885:Ubxn10 UTSW 4 138,447,881 (GRCm39) missense probably damaging 1.00
R2031:Ubxn10 UTSW 4 138,448,574 (GRCm39) missense possibly damaging 0.92
R4117:Ubxn10 UTSW 4 138,448,276 (GRCm39) missense probably benign 0.01
R4461:Ubxn10 UTSW 4 138,448,187 (GRCm39) missense probably benign 0.31
R4737:Ubxn10 UTSW 4 138,463,259 (GRCm39) intron probably benign
R4804:Ubxn10 UTSW 4 138,448,515 (GRCm39) missense possibly damaging 0.71
R5739:Ubxn10 UTSW 4 138,448,134 (GRCm39) missense probably benign 0.01
R6524:Ubxn10 UTSW 4 138,448,194 (GRCm39) nonsense probably null
R7252:Ubxn10 UTSW 4 138,448,187 (GRCm39) missense probably benign
R9189:Ubxn10 UTSW 4 138,448,133 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CTAAGAGTTGCTCAGCCTCC -3'
(R):5'- CATTCAAGATGGGTTGGCAGC -3'

Sequencing Primer
(F):5'- GAAAGCAGCAGATCCTGGCC -3'
(R):5'- GGTTGGCAGCCATATTCCTTAAGC -3'
Posted On 2021-07-15