Incidental Mutation 'R8824:Prkcz'
ID673317
Institutional Source Beutler Lab
Gene Symbol Prkcz
Ensembl Gene ENSMUSG00000029053
Gene Nameprotein kinase C, zeta
SynonymsPkcz, zetaPKC, aPKCzeta
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8824 (G1)
Quality Score139.008
Status Not validated
Chromosome4
Chromosomal Location155260129-155361361 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to A at 155344828 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030922] [ENSMUST00000103178] [ENSMUST00000123652] [ENSMUST00000131975]
Predicted Effect probably benign
Transcript: ENSMUST00000030922
SMART Domains Protein: ENSMUSP00000030922
Gene: ENSMUSG00000029053

DomainStartEndE-ValueType
PB1 15 98 4.55e-24 SMART
C1 131 180 6.73e-17 SMART
S_TKc 252 518 5.49e-94 SMART
S_TK_X 519 582 2.58e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103178
SMART Domains Protein: ENSMUSP00000099467
Gene: ENSMUSG00000029053

DomainStartEndE-ValueType
S_TKc 69 335 5.49e-94 SMART
S_TK_X 336 399 2.58e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123652
Predicted Effect probably benign
Transcript: ENSMUST00000131975
SMART Domains Protein: ENSMUSP00000116042
Gene: ENSMUSG00000029053

DomainStartEndE-ValueType
C1 23 72 6.73e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) zeta is a member of the PKC family of serine/threonine kinases which are involved in a variety of cellular processes such as proliferation, differentiation and secretion. Unlike the classical PKC isoenzymes which are calcium-dependent, PKC zeta exhibits a kinase activity which is independent of calcium and diacylglycerol but not of phosphatidylserine. Furthermore, it is insensitive to typical PKC inhibitors and cannot be activated by phorbol ester. Unlike the classical PKC isoenzymes, it has only a single zinc finger module. These structural and biochemical properties indicate that the zeta subspecies is related to, but distinct from other isoenzymes of PKC. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Young, not mature, homozygous null mice have reduced B cell numbers and abnormal secondary lymph organ structure. Young mice have fewer Peyer's patches, poor delineation of B & T cell zones, and fewer follicles of small size. Spleens have less prominent B cell follicles and abnormal marginal zones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl A T 2: 93,862,850 V260D probably damaging Het
Adora2a G A 10: 75,326,179 A51T probably damaging Het
Afg1l G A 10: 42,438,387 P128S possibly damaging Het
Ago4 C A 4: 126,507,184 V623L probably benign Het
Akap11 A T 14: 78,516,347 N112K Het
C1ra A T 6: 124,517,695 I306F probably damaging Het
Ccdc73 A G 2: 104,991,877 N724D possibly damaging Het
Cd248 A G 19: 5,069,617 I498V probably benign Het
Clrn1 A T 3: 58,884,893 S50T probably benign Het
Col7a1 A G 9: 108,967,025 K1553R unknown Het
Cxcr6 A C 9: 123,810,941 T343P probably benign Het
Cyp11b2 T A 15: 74,856,065 Q56L probably damaging Het
Dip2a A G 10: 76,278,486 probably null Het
Dnmbp A G 19: 43,849,837 V742A probably benign Het
Dusp16 A T 6: 134,739,769 S192T probably benign Het
Ehbp1 A T 11: 22,232,053 D87E probably damaging Het
Fgl1 A G 8: 41,199,711 V150A probably benign Het
Flt3 T C 5: 147,334,863 D873G probably damaging Het
Gart T C 16: 91,630,703 D469G possibly damaging Het
Gm28168 T G 1: 117,947,895 S85A probably benign Het
Golgb1 A G 16: 36,915,689 D1807G probably benign Het
Grm8 A G 6: 27,761,352 L291S probably damaging Het
Gucy2d C T 7: 98,443,469 P18S possibly damaging Het
Ifna15 C T 4: 88,557,761 C162Y probably damaging Het
Iqub C A 6: 24,479,308 E412* probably null Het
Krt4 T A 15: 101,920,642 D312V Het
Krtap26-1 A T 16: 88,647,415 I106N probably damaging Het
Krtap26-1 T C 16: 88,647,436 Y99C probably damaging Het
Lipn T C 19: 34,084,716 I357T probably benign Het
Lrrc14b A G 13: 74,363,949 L4P probably damaging Het
Mrgpra9 A T 7: 47,235,293 C209S probably benign Het
Myh7b A G 2: 155,630,381 N1291D probably benign Het
Myo5a A G 9: 75,167,046 T746A probably damaging Het
Myom2 A C 8: 15,114,169 E1021D possibly damaging Het
Ncoa2 C T 1: 13,177,185 R338H probably benign Het
Ncor2 A G 5: 125,118,757 F91L Het
Neb C G 2: 52,216,911 A4407P probably damaging Het
Olfr1135 T C 2: 87,671,960 M136V possibly damaging Het
Olfr347 A T 2: 36,735,191 Y290F probably damaging Het
Olfr502 T G 7: 108,523,143 Y269S probably benign Het
Olfr74 A G 2: 87,974,003 F221L probably benign Het
Olfr819 C T 10: 129,965,792 V297M probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Piwil4 C A 9: 14,727,475 K298N probably benign Het
Prkg2 G A 5: 98,942,208 P691L possibly damaging Het
Ptprc T A 1: 138,113,708 K89* probably null Het
Rapgef3 C T 15: 97,766,908 A25T probably benign Het
Rreb1 C T 13: 37,930,516 T617I probably damaging Het
Rsph1 A C 17: 31,273,376 V72G possibly damaging Het
Shc2 A G 10: 79,637,702 V50A probably benign Het
Slc38a9 G A 13: 112,701,487 R262H probably benign Het
Slco6c1 T A 1: 97,128,159 N6Y possibly damaging Het
Smarca5 A G 8: 80,705,332 F886L probably benign Het
Trim30b T A 7: 104,357,906 probably benign Het
Trim55 T C 3: 19,672,962 S398P probably benign Het
Ubxn10 A G 4: 138,735,867 probably null Het
Usf3 A G 16: 44,215,613 N152S probably benign Het
Vps13b T A 15: 35,533,299 V839E probably damaging Het
Zfp780b T C 7: 27,963,468 Y554C probably benign Het
Zhx2 C T 15: 57,821,280 T15I probably damaging Het
Other mutations in Prkcz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Prkcz APN 4 155294401 splice site probably benign
IGL02114:Prkcz APN 4 155271590 missense probably damaging 1.00
IGL02582:Prkcz APN 4 155271256 missense probably damaging 1.00
IGL03010:Prkcz APN 4 155286805 missense probably damaging 1.00
IGL03199:Prkcz APN 4 155272984 missense possibly damaging 0.85
IGL03225:Prkcz APN 4 155268195 missense probably damaging 0.99
IGL03229:Prkcz APN 4 155262506 missense probably benign 0.19
IGL03299:Prkcz APN 4 155286790 missense possibly damaging 0.78
PIT4403001:Prkcz UTSW 4 155293156 critical splice donor site probably null
R0389:Prkcz UTSW 4 155269140 missense probably damaging 1.00
R0443:Prkcz UTSW 4 155269140 missense probably damaging 1.00
R1666:Prkcz UTSW 4 155289751 missense probably damaging 1.00
R1668:Prkcz UTSW 4 155289751 missense probably damaging 1.00
R1686:Prkcz UTSW 4 155271256 missense probably damaging 1.00
R1710:Prkcz UTSW 4 155262512 missense probably damaging 1.00
R2025:Prkcz UTSW 4 155289710 missense probably damaging 1.00
R3162:Prkcz UTSW 4 155290524 missense probably benign 0.00
R3162:Prkcz UTSW 4 155290524 missense probably benign 0.00
R4399:Prkcz UTSW 4 155269077 missense possibly damaging 0.86
R4780:Prkcz UTSW 4 155289702 missense probably damaging 1.00
R4923:Prkcz UTSW 4 155357489 missense probably damaging 1.00
R5160:Prkcz UTSW 4 155293232 missense probably benign 0.22
R5510:Prkcz UTSW 4 155272936 splice site probably null
R6278:Prkcz UTSW 4 155268195 missense probably damaging 0.99
R6290:Prkcz UTSW 4 155356499 missense probably damaging 1.00
R6881:Prkcz UTSW 4 155269056 missense possibly damaging 0.90
R7055:Prkcz UTSW 4 155289634 missense probably benign 0.01
R7108:Prkcz UTSW 4 155286793 nonsense probably null
R7241:Prkcz UTSW 4 155269059 missense probably benign 0.00
R7355:Prkcz UTSW 4 155357496 missense probably damaging 1.00
R7466:Prkcz UTSW 4 155271602 missense probably damaging 1.00
R7522:Prkcz UTSW 4 155271285 missense probably damaging 1.00
R7618:Prkcz UTSW 4 155262482 missense probably damaging 1.00
R7753:Prkcz UTSW 4 155272968 missense possibly damaging 0.61
R8079:Prkcz UTSW 4 155357505 missense probably damaging 1.00
R8407:Prkcz UTSW 4 155268216 missense probably damaging 0.99
R8523:Prkcz UTSW 4 155262511 missense probably damaging 1.00
X0067:Prkcz UTSW 4 155354704 missense probably benign 0.25
Z1176:Prkcz UTSW 4 155354680 missense probably damaging 1.00
Z1176:Prkcz UTSW 4 155356468 missense probably damaging 1.00
Z1177:Prkcz UTSW 4 155301004 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCGTCAGAAAAGCATCCC -3'
(R):5'- TGGTCAGAGCAAACATGCATGTC -3'

Sequencing Primer
(F):5'- TCAATCCTGTACAGCCCTCAG -3'
(R):5'- ATGGGACCACAACGATGA -3'
Posted On2021-07-15