Mutagenetix > Incidental Mutation

Incidental Mutation 'R8824:Prkg2'

673318

Institutional Source

Beutler Lab

Gene Symbol

Prkg2

Ensembl Gene

ENSMUSG00000029334

Gene Name

protein kinase, cGMP-dependent, type II

Synonyms

Prkgr2, cGK-II

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_008926.4; MGI: 108173

Is this an essential gene?

Probably non essential (E-score: 0.152) question?

Stock #

R8824 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

98929773-99037351 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 98942208 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 691 (P691L)

Ref Sequence

ENSEMBL: ENSMUSP00000124963 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031277] [ENSMUST00000161490] [ENSMUST00000162147] [ENSMUST00000162619]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031277
AA Change: P662L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000031277
Gene: ENSMUSG00000029334
AA Change: P662L

Domain	Start	End	E-Value	Type
coiled coil region	19	85	N/A	INTRINSIC
cNMP	168	284	2.82e-19	SMART
cNMP	286	409	3.02e-28	SMART
S_TKc	424	682	9.46e-75	SMART
S_TK_X	683	733	9.83e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161490
AA Change: P691L

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000124963
Gene: ENSMUSG00000029334
AA Change: P691L

Domain	Start	End	E-Value	Type
coiled coil region	19	85	N/A	INTRINSIC
cNMP	168	284	2.82e-19	SMART
cNMP	286	409	3.02e-28	SMART
S_TKc	453	711	1.19e-89	SMART
S_TK_X	712	762	9.83e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162147
AA Change: P36L

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000143708
Gene: ENSMUSG00000029334
AA Change: P36L

Domain	Start	End	E-Value	Type
Blast:S_TKc	1	56	3e-32	BLAST
S_TK_X	57	107	4.7e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162619
AA Change: P23L

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000142743
Gene: ENSMUSG00000029334
AA Change: P23L

Domain	Start	End	E-Value	Type
Blast:S_TKc	1	43	8e-23	BLAST
S_TK_X	44	94	4.6e-6	SMART

Meta Mutation Damage Score

0.9409

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (63/63)

MGI Phenotype

Strain: 24494704
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine/threonine protein kinase family of proteins. The encoded protein plays a role in the regulation of fluid balance in the intestine. A similar protein in mouse is thought to regulate differentiation and proliferation of cells in the colon. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice exhibit dwarfism, with abnormal skull morphology and short limbs and vertebrae. Defects in axial organization of the growth plates was evident as mice aged. Digestive secretion in response to enterotoxin was reduced. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Accsl	A	T	2: 93,862,850	V260D	probably damaging	Het
Adora2a	G	A	10: 75,326,179	A51T	probably damaging	Het
Afg1l	G	A	10: 42,438,387	P128S	possibly damaging	Het
Ago4	C	A	4: 126,507,184	V623L	probably benign	Het
Akap11	A	T	14: 78,516,347	N112K		Het
C1ra	A	T	6: 124,517,695	I306F	probably damaging	Het
Ccdc73	A	G	2: 104,991,877	N724D	possibly damaging	Het
Cd248	A	G	19: 5,069,617	I498V	probably benign	Het
Clrn1	A	T	3: 58,884,893	S50T	probably benign	Het
Col7a1	A	G	9: 108,967,025	K1553R	unknown	Het
Cxcr6	A	C	9: 123,810,941	T343P	probably benign	Het
Cyp11b2	T	A	15: 74,856,065	Q56L	probably damaging	Het
Dip2a	A	G	10: 76,278,486		probably null	Het
Dnmbp	A	G	19: 43,849,837	V742A	probably benign	Het
Dusp16	A	T	6: 134,739,769	S192T	probably benign	Het
Ehbp1	A	T	11: 22,232,053	D87E	probably damaging	Het
Fgl1	A	G	8: 41,199,711	V150A	probably benign	Het
Flt3	T	C	5: 147,334,863	D873G	probably damaging	Het
Gart	T	C	16: 91,630,703	D469G	possibly damaging	Het
Gm28168	T	G	1: 117,947,895	S85A	probably benign	Het
Golgb1	A	G	16: 36,915,689	D1807G	probably benign	Het
Grm8	A	G	6: 27,761,352	L291S	probably damaging	Het
Gucy2d	C	T	7: 98,443,469	P18S	possibly damaging	Het
Ifna15	C	T	4: 88,557,761	C162Y	probably damaging	Het
Iqub	C	A	6: 24,479,308	E412*	probably null	Het
Krt4	T	A	15: 101,920,642	D312V		Het
Krtap26-1	A	T	16: 88,647,415	I106N	probably damaging	Het
Krtap26-1	T	C	16: 88,647,436	Y99C	probably damaging	Het
Lipn	T	C	19: 34,084,716	I357T	probably benign	Het
Lrrc14b	A	G	13: 74,363,949	L4P	probably damaging	Het
Mrgpra9	A	T	7: 47,235,293	C209S	probably benign	Het
Myh7b	A	G	2: 155,630,381	N1291D	probably benign	Het
Myo5a	A	G	9: 75,167,046	T746A	probably damaging	Het
Myom2	A	C	8: 15,114,169	E1021D	possibly damaging	Het
Ncoa2	C	T	1: 13,177,185	R338H	probably benign	Het
Ncor2	A	G	5: 125,118,757	F91L		Het
Neb	C	G	2: 52,216,911	A4407P	probably damaging	Het
Olfr1135	T	C	2: 87,671,960	M136V	possibly damaging	Het
Olfr1272	A	G	2: 90,296,012	I283T	probably damaging	Het
Olfr347	A	T	2: 36,735,191	Y290F	probably damaging	Het
Olfr502	T	G	7: 108,523,143	Y269S	probably benign	Het
Olfr74	A	G	2: 87,974,003	F221L	probably benign	Het
Olfr819	C	T	10: 129,965,792	V297M	probably damaging	Het
Peg10	T	TCCC	6: 4,756,451		probably benign	Het
Piwil4	C	A	9: 14,727,475	K298N	probably benign	Het
Prkcz	G	A	4: 155,344,828		probably benign	Het
Ptprc	T	A	1: 138,113,708	K89*	probably null	Het
Rapgef3	C	T	15: 97,766,908	A25T	probably benign	Het
Rreb1	C	T	13: 37,930,516	T617I	probably damaging	Het
Rsph1	A	C	17: 31,273,376	V72G	possibly damaging	Het
Shc2	A	G	10: 79,637,702	V50A	probably benign	Het
Slc38a9	G	A	13: 112,701,487	R262H	probably benign	Het
Slco6c1	T	A	1: 97,128,159	N6Y	possibly damaging	Het
Smarca5	A	G	8: 80,705,332	F886L	probably benign	Het
Tas1r2	A	G	4: 139,653,763		probably benign	Het
Tnrc6c	T	A	11: 117,739,854		probably benign	Het
Trim30b	T	A	7: 104,357,906		probably benign	Het
Trim55	T	C	3: 19,672,962	S398P	probably benign	Het
Ttc39c	T	A	18: 12,686,946		probably benign	Het
Ubxn10	A	G	4: 138,735,867		probably null	Het
Usf3	A	G	16: 44,215,613	N152S	probably benign	Het
Vps13b	T	A	15: 35,533,299	V839E	probably damaging	Het
Zeb1	T	A	18: 5,748,680		probably benign	Het
Zfp780b	T	C	7: 27,963,468	Y554C	probably benign	Het
Zhx2	C	T	15: 57,821,280	T15I	probably damaging	Het

Other mutations in Prkg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Prkg2	APN	5	99024541	missense	probably benign	0.00
IGL01063:Prkg2	APN	5	98969936	critical splice donor site	probably null
IGL02060:Prkg2	APN	5	99024515	missense	probably benign	0.32
IGL02666:Prkg2	APN	5	98997519	splice site	probably benign
IGL02992:Prkg2	APN	5	99024506	missense	probably benign
IGL03040:Prkg2	APN	5	98973107	critical splice donor site	probably null
devito	UTSW	5	98966510	critical splice donor site	probably null
Goldwyn	UTSW	5	98942208	missense	possibly damaging	0.86
kilmer	UTSW	5	98947474	missense	probably damaging	1.00
Pulp	UTSW	5	98976462	missense	possibly damaging	0.92
travolta	UTSW	5	98969980	missense	probably damaging	1.00
P0005:Prkg2	UTSW	5	98969947	missense	probably damaging	1.00
R0044:Prkg2	UTSW	5	98973130	missense	probably damaging	0.98
R0044:Prkg2	UTSW	5	98973130	missense	probably damaging	0.98
R0115:Prkg2	UTSW	5	98994655	splice site	probably null
R0403:Prkg2	UTSW	5	98994645	missense	possibly damaging	0.95
R0452:Prkg2	UTSW	5	98997520	splice site	probably benign
R0481:Prkg2	UTSW	5	98994655	splice site	probably null
R1194:Prkg2	UTSW	5	98971926	missense	probably benign	0.00
R1534:Prkg2	UTSW	5	98994561	missense	probably damaging	1.00
R1861:Prkg2	UTSW	5	98947416	missense	probably damaging	1.00
R2010:Prkg2	UTSW	5	99024805	missense	probably benign
R2031:Prkg2	UTSW	5	99024451	missense	possibly damaging	0.85
R2176:Prkg2	UTSW	5	98966509	splice site	probably benign
R3607:Prkg2	UTSW	5	98947377	missense	probably damaging	1.00
R3958:Prkg2	UTSW	5	98997495	missense	possibly damaging	0.84
R3960:Prkg2	UTSW	5	98997495	missense	possibly damaging	0.84
R4012:Prkg2	UTSW	5	98979815	missense	possibly damaging	0.93
R4794:Prkg2	UTSW	5	98966633	missense	probably damaging	1.00
R4840:Prkg2	UTSW	5	98981143	missense	probably benign	0.03
R4867:Prkg2	UTSW	5	99024709	missense	probably benign	0.21
R5182:Prkg2	UTSW	5	99024709	missense	probably benign	0.21
R5226:Prkg2	UTSW	5	98976462	missense	possibly damaging	0.92
R5274:Prkg2	UTSW	5	98969991	missense	probably damaging	1.00
R5416:Prkg2	UTSW	5	98943467	missense	probably benign	0.05
R5531:Prkg2	UTSW	5	98967734	missense	probably damaging	1.00
R5619:Prkg2	UTSW	5	98988297	missense	probably damaging	1.00
R6264:Prkg2	UTSW	5	98934364	missense	probably benign	0.22
R6925:Prkg2	UTSW	5	98966510	critical splice donor site	probably null
R7971:Prkg2	UTSW	5	98932014	missense	probably damaging	1.00
R8210:Prkg2	UTSW	5	98966534	missense	probably damaging	1.00
R8788:Prkg2	UTSW	5	98969980	missense	probably damaging	1.00
R8825:Prkg2	UTSW	5	98942184	missense	probably benign	0.02
R8932:Prkg2	UTSW	5	98947440	missense	possibly damaging	0.80
R8950:Prkg2	UTSW	5	98971956	missense	possibly damaging	0.54
R9026:Prkg2	UTSW	5	98966527	missense	probably benign
R9210:Prkg2	UTSW	5	98947474	missense	probably damaging	1.00
R9363:Prkg2	UTSW	5	99024398	missense	probably benign	0.30
R9627:Prkg2	UTSW	5	98932010	makesense	probably null
Z1088:Prkg2	UTSW	5	99024804	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGAACCTGCCATGGTCATCTC -3'
(R):5'- ATCCAGACACTCAGCTGCAG -3'

Sequencing Primer
(F):5'- CTGTGAGATGAAATGAGCCCTTCC -3'
(R):5'- TGCAGCTCCTCCATGGAAG -3'

Posted On

2021-07-15