Incidental Mutation 'R8824:Prkg2'
ID 673318
Institutional Source Beutler Lab
Gene Symbol Prkg2
Ensembl Gene ENSMUSG00000029334
Gene Name protein kinase, cGMP-dependent, type II
Synonyms Prkgr2, cGK-II
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_008926.4; MGI: 108173

Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock # R8824 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 98929773-99037351 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 98942208 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 691 (P691L)
Ref Sequence ENSEMBL: ENSMUSP00000124963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031277] [ENSMUST00000161490] [ENSMUST00000162147] [ENSMUST00000162619]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000031277
AA Change: P662L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031277
Gene: ENSMUSG00000029334
AA Change: P662L

DomainStartEndE-ValueType
coiled coil region 19 85 N/A INTRINSIC
cNMP 168 284 2.82e-19 SMART
cNMP 286 409 3.02e-28 SMART
S_TKc 424 682 9.46e-75 SMART
S_TK_X 683 733 9.83e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161490
AA Change: P691L

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124963
Gene: ENSMUSG00000029334
AA Change: P691L

DomainStartEndE-ValueType
coiled coil region 19 85 N/A INTRINSIC
cNMP 168 284 2.82e-19 SMART
cNMP 286 409 3.02e-28 SMART
S_TKc 453 711 1.19e-89 SMART
S_TK_X 712 762 9.83e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162147
AA Change: P36L

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143708
Gene: ENSMUSG00000029334
AA Change: P36L

DomainStartEndE-ValueType
Blast:S_TKc 1 56 3e-32 BLAST
S_TK_X 57 107 4.7e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162619
AA Change: P23L

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142743
Gene: ENSMUSG00000029334
AA Change: P23L

DomainStartEndE-ValueType
Blast:S_TKc 1 43 8e-23 BLAST
S_TK_X 44 94 4.6e-6 SMART
Meta Mutation Damage Score 0.9409 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (63/63)
MGI Phenotype Strain: 24494704
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine/threonine protein kinase family of proteins. The encoded protein plays a role in the regulation of fluid balance in the intestine. A similar protein in mouse is thought to regulate differentiation and proliferation of cells in the colon. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice exhibit dwarfism, with abnormal skull morphology and short limbs and vertebrae. Defects in axial organization of the growth plates was evident as mice aged. Digestive secretion in response to enterotoxin was reduced. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl A T 2: 93,862,850 V260D probably damaging Het
Adora2a G A 10: 75,326,179 A51T probably damaging Het
Afg1l G A 10: 42,438,387 P128S possibly damaging Het
Ago4 C A 4: 126,507,184 V623L probably benign Het
Akap11 A T 14: 78,516,347 N112K Het
C1ra A T 6: 124,517,695 I306F probably damaging Het
Ccdc73 A G 2: 104,991,877 N724D possibly damaging Het
Cd248 A G 19: 5,069,617 I498V probably benign Het
Clrn1 A T 3: 58,884,893 S50T probably benign Het
Col7a1 A G 9: 108,967,025 K1553R unknown Het
Cxcr6 A C 9: 123,810,941 T343P probably benign Het
Cyp11b2 T A 15: 74,856,065 Q56L probably damaging Het
Dip2a A G 10: 76,278,486 probably null Het
Dnmbp A G 19: 43,849,837 V742A probably benign Het
Dusp16 A T 6: 134,739,769 S192T probably benign Het
Ehbp1 A T 11: 22,232,053 D87E probably damaging Het
Fgl1 A G 8: 41,199,711 V150A probably benign Het
Flt3 T C 5: 147,334,863 D873G probably damaging Het
Gart T C 16: 91,630,703 D469G possibly damaging Het
Gm28168 T G 1: 117,947,895 S85A probably benign Het
Golgb1 A G 16: 36,915,689 D1807G probably benign Het
Grm8 A G 6: 27,761,352 L291S probably damaging Het
Gucy2d C T 7: 98,443,469 P18S possibly damaging Het
Ifna15 C T 4: 88,557,761 C162Y probably damaging Het
Iqub C A 6: 24,479,308 E412* probably null Het
Krt4 T A 15: 101,920,642 D312V Het
Krtap26-1 A T 16: 88,647,415 I106N probably damaging Het
Krtap26-1 T C 16: 88,647,436 Y99C probably damaging Het
Lipn T C 19: 34,084,716 I357T probably benign Het
Lrrc14b A G 13: 74,363,949 L4P probably damaging Het
Mrgpra9 A T 7: 47,235,293 C209S probably benign Het
Myh7b A G 2: 155,630,381 N1291D probably benign Het
Myo5a A G 9: 75,167,046 T746A probably damaging Het
Myom2 A C 8: 15,114,169 E1021D possibly damaging Het
Ncoa2 C T 1: 13,177,185 R338H probably benign Het
Ncor2 A G 5: 125,118,757 F91L Het
Neb C G 2: 52,216,911 A4407P probably damaging Het
Olfr1135 T C 2: 87,671,960 M136V possibly damaging Het
Olfr1272 A G 2: 90,296,012 I283T probably damaging Het
Olfr347 A T 2: 36,735,191 Y290F probably damaging Het
Olfr502 T G 7: 108,523,143 Y269S probably benign Het
Olfr74 A G 2: 87,974,003 F221L probably benign Het
Olfr819 C T 10: 129,965,792 V297M probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Piwil4 C A 9: 14,727,475 K298N probably benign Het
Prkcz G A 4: 155,344,828 probably benign Het
Ptprc T A 1: 138,113,708 K89* probably null Het
Rapgef3 C T 15: 97,766,908 A25T probably benign Het
Rreb1 C T 13: 37,930,516 T617I probably damaging Het
Rsph1 A C 17: 31,273,376 V72G possibly damaging Het
Shc2 A G 10: 79,637,702 V50A probably benign Het
Slc38a9 G A 13: 112,701,487 R262H probably benign Het
Slco6c1 T A 1: 97,128,159 N6Y possibly damaging Het
Smarca5 A G 8: 80,705,332 F886L probably benign Het
Tas1r2 A G 4: 139,653,763 probably benign Het
Tnrc6c T A 11: 117,739,854 probably benign Het
Trim30b T A 7: 104,357,906 probably benign Het
Trim55 T C 3: 19,672,962 S398P probably benign Het
Ttc39c T A 18: 12,686,946 probably benign Het
Ubxn10 A G 4: 138,735,867 probably null Het
Usf3 A G 16: 44,215,613 N152S probably benign Het
Vps13b T A 15: 35,533,299 V839E probably damaging Het
Zeb1 T A 18: 5,748,680 probably benign Het
Zfp780b T C 7: 27,963,468 Y554C probably benign Het
Zhx2 C T 15: 57,821,280 T15I probably damaging Het
Other mutations in Prkg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Prkg2 APN 5 99024541 missense probably benign 0.00
IGL01063:Prkg2 APN 5 98969936 critical splice donor site probably null
IGL02060:Prkg2 APN 5 99024515 missense probably benign 0.32
IGL02666:Prkg2 APN 5 98997519 splice site probably benign
IGL02992:Prkg2 APN 5 99024506 missense probably benign
IGL03040:Prkg2 APN 5 98973107 critical splice donor site probably null
devito UTSW 5 98966510 critical splice donor site probably null
Goldwyn UTSW 5 98942208 missense possibly damaging 0.86
kilmer UTSW 5 98947474 missense probably damaging 1.00
Pulp UTSW 5 98976462 missense possibly damaging 0.92
travolta UTSW 5 98969980 missense probably damaging 1.00
P0005:Prkg2 UTSW 5 98969947 missense probably damaging 1.00
R0044:Prkg2 UTSW 5 98973130 missense probably damaging 0.98
R0044:Prkg2 UTSW 5 98973130 missense probably damaging 0.98
R0115:Prkg2 UTSW 5 98994655 splice site probably null
R0403:Prkg2 UTSW 5 98994645 missense possibly damaging 0.95
R0452:Prkg2 UTSW 5 98997520 splice site probably benign
R0481:Prkg2 UTSW 5 98994655 splice site probably null
R1194:Prkg2 UTSW 5 98971926 missense probably benign 0.00
R1534:Prkg2 UTSW 5 98994561 missense probably damaging 1.00
R1861:Prkg2 UTSW 5 98947416 missense probably damaging 1.00
R2010:Prkg2 UTSW 5 99024805 missense probably benign
R2031:Prkg2 UTSW 5 99024451 missense possibly damaging 0.85
R2176:Prkg2 UTSW 5 98966509 splice site probably benign
R3607:Prkg2 UTSW 5 98947377 missense probably damaging 1.00
R3958:Prkg2 UTSW 5 98997495 missense possibly damaging 0.84
R3960:Prkg2 UTSW 5 98997495 missense possibly damaging 0.84
R4012:Prkg2 UTSW 5 98979815 missense possibly damaging 0.93
R4794:Prkg2 UTSW 5 98966633 missense probably damaging 1.00
R4840:Prkg2 UTSW 5 98981143 missense probably benign 0.03
R4867:Prkg2 UTSW 5 99024709 missense probably benign 0.21
R5182:Prkg2 UTSW 5 99024709 missense probably benign 0.21
R5226:Prkg2 UTSW 5 98976462 missense possibly damaging 0.92
R5274:Prkg2 UTSW 5 98969991 missense probably damaging 1.00
R5416:Prkg2 UTSW 5 98943467 missense probably benign 0.05
R5531:Prkg2 UTSW 5 98967734 missense probably damaging 1.00
R5619:Prkg2 UTSW 5 98988297 missense probably damaging 1.00
R6264:Prkg2 UTSW 5 98934364 missense probably benign 0.22
R6925:Prkg2 UTSW 5 98966510 critical splice donor site probably null
R7971:Prkg2 UTSW 5 98932014 missense probably damaging 1.00
R8210:Prkg2 UTSW 5 98966534 missense probably damaging 1.00
R8788:Prkg2 UTSW 5 98969980 missense probably damaging 1.00
R8825:Prkg2 UTSW 5 98942184 missense probably benign 0.02
R8932:Prkg2 UTSW 5 98947440 missense possibly damaging 0.80
R8950:Prkg2 UTSW 5 98971956 missense possibly damaging 0.54
R9026:Prkg2 UTSW 5 98966527 missense probably benign
R9210:Prkg2 UTSW 5 98947474 missense probably damaging 1.00
R9363:Prkg2 UTSW 5 99024398 missense probably benign 0.30
R9627:Prkg2 UTSW 5 98932010 makesense probably null
Z1088:Prkg2 UTSW 5 99024804 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAACCTGCCATGGTCATCTC -3'
(R):5'- ATCCAGACACTCAGCTGCAG -3'

Sequencing Primer
(F):5'- CTGTGAGATGAAATGAGCCCTTCC -3'
(R):5'- TGCAGCTCCTCCATGGAAG -3'
Posted On 2021-07-15