Mutagenetix > Incidental Mutation

Incidental Mutation 'R8824:Grm8'

673323

Institutional Source

Beutler Lab

Gene Symbol

Grm8

Ensembl Gene

ENSMUSG00000024211

Gene Name

glutamate receptor, metabotropic 8

Synonyms

mGluR8, Gprc1h

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8824 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

27275119-28135178 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 27761352 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 291 (L291S)

Ref Sequence

ENSEMBL: ENSMUSP00000087998 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090512] [ENSMUST00000115323] [ENSMUST00000115324] [ENSMUST00000131897]

AlphaFold

P47743

Predicted Effect

probably damaging
Transcript: ENSMUST00000090512
AA Change: L291S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000087998
Gene: ENSMUSG00000024211
AA Change: L291S

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	74	478	9.6e-102	PFAM
Pfam:Peripla_BP_6	141	375	1.3e-9	PFAM
Pfam:NCD3G	512	562	5e-17	PFAM
Pfam:7tm_3	593	841	4.7e-88	PFAM
low complexity region	887	905	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115323
AA Change: L291S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000110978
Gene: ENSMUSG00000024211
AA Change: L291S

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	74	478	3.3e-107	PFAM
Pfam:NCD3G	512	562	9e-14	PFAM
Pfam:7tm_3	595	840	6.8e-58	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115324
AA Change: L291S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000110979
Gene: ENSMUSG00000024211
AA Change: L291S

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	74	478	2.1e-101	PFAM
Pfam:Peripla_BP_6	141	375	9.2e-10	PFAM
Pfam:NCD3G	512	562	2.8e-16	PFAM
Pfam:7tm_3	593	841	2.4e-87	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000131897
AA Change: L291S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000120394
Gene: ENSMUSG00000024211
AA Change: L291S

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	74	294	5.8e-66	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overweight and mildly insulin resistant, and display increased anxiety-related responses and reduced exploration in a new environment. Mice homozygous for a different knock-out allele exhibit altered excitatory responses in the dentate gyrus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Accsl	A	T	2: 93,862,850	V260D	probably damaging	Het
Adora2a	G	A	10: 75,326,179	A51T	probably damaging	Het
Afg1l	G	A	10: 42,438,387	P128S	possibly damaging	Het
Ago4	C	A	4: 126,507,184	V623L	probably benign	Het
Akap11	A	T	14: 78,516,347	N112K		Het
C1ra	A	T	6: 124,517,695	I306F	probably damaging	Het
Ccdc73	A	G	2: 104,991,877	N724D	possibly damaging	Het
Cd248	A	G	19: 5,069,617	I498V	probably benign	Het
Clrn1	A	T	3: 58,884,893	S50T	probably benign	Het
Col7a1	A	G	9: 108,967,025	K1553R	unknown	Het
Cxcr6	A	C	9: 123,810,941	T343P	probably benign	Het
Cyp11b2	T	A	15: 74,856,065	Q56L	probably damaging	Het
Dip2a	A	G	10: 76,278,486		probably null	Het
Dnmbp	A	G	19: 43,849,837	V742A	probably benign	Het
Dusp16	A	T	6: 134,739,769	S192T	probably benign	Het
Ehbp1	A	T	11: 22,232,053	D87E	probably damaging	Het
Fgl1	A	G	8: 41,199,711	V150A	probably benign	Het
Flt3	T	C	5: 147,334,863	D873G	probably damaging	Het
Gart	T	C	16: 91,630,703	D469G	possibly damaging	Het
Gm28168	T	G	1: 117,947,895	S85A	probably benign	Het
Golgb1	A	G	16: 36,915,689	D1807G	probably benign	Het
Gucy2d	C	T	7: 98,443,469	P18S	possibly damaging	Het
Ifna15	C	T	4: 88,557,761	C162Y	probably damaging	Het
Iqub	C	A	6: 24,479,308	E412*	probably null	Het
Krt4	T	A	15: 101,920,642	D312V		Het
Krtap26-1	A	T	16: 88,647,415	I106N	probably damaging	Het
Krtap26-1	T	C	16: 88,647,436	Y99C	probably damaging	Het
Lipn	T	C	19: 34,084,716	I357T	probably benign	Het
Lrrc14b	A	G	13: 74,363,949	L4P	probably damaging	Het
Mrgpra9	A	T	7: 47,235,293	C209S	probably benign	Het
Myh7b	A	G	2: 155,630,381	N1291D	probably benign	Het
Myo5a	A	G	9: 75,167,046	T746A	probably damaging	Het
Myom2	A	C	8: 15,114,169	E1021D	possibly damaging	Het
Ncoa2	C	T	1: 13,177,185	R338H	probably benign	Het
Ncor2	A	G	5: 125,118,757	F91L		Het
Neb	C	G	2: 52,216,911	A4407P	probably damaging	Het
Olfr1135	T	C	2: 87,671,960	M136V	possibly damaging	Het
Olfr1272	A	G	2: 90,296,012	I283T	probably damaging	Het
Olfr347	A	T	2: 36,735,191	Y290F	probably damaging	Het
Olfr502	T	G	7: 108,523,143	Y269S	probably benign	Het
Olfr74	A	G	2: 87,974,003	F221L	probably benign	Het
Olfr819	C	T	10: 129,965,792	V297M	probably damaging	Het
Peg10	T	TCCC	6: 4,756,451		probably benign	Het
Piwil4	C	A	9: 14,727,475	K298N	probably benign	Het
Prkcz	G	A	4: 155,344,828		probably benign	Het
Prkg2	G	A	5: 98,942,208	P691L	possibly damaging	Het
Ptprc	T	A	1: 138,113,708	K89*	probably null	Het
Rapgef3	C	T	15: 97,766,908	A25T	probably benign	Het
Rreb1	C	T	13: 37,930,516	T617I	probably damaging	Het
Rsph1	A	C	17: 31,273,376	V72G	possibly damaging	Het
Shc2	A	G	10: 79,637,702	V50A	probably benign	Het
Slc38a9	G	A	13: 112,701,487	R262H	probably benign	Het
Slco6c1	T	A	1: 97,128,159	N6Y	possibly damaging	Het
Smarca5	A	G	8: 80,705,332	F886L	probably benign	Het
Tas1r2	A	G	4: 139,653,763		probably benign	Het
Tnrc6c	T	A	11: 117,739,854		probably benign	Het
Trim30b	T	A	7: 104,357,906		probably benign	Het
Trim55	T	C	3: 19,672,962	S398P	probably benign	Het
Ttc39c	T	A	18: 12,686,946		probably benign	Het
Ubxn10	A	G	4: 138,735,867		probably null	Het
Usf3	A	G	16: 44,215,613	N152S	probably benign	Het
Vps13b	T	A	15: 35,533,299	V839E	probably damaging	Het
Zeb1	T	A	18: 5,748,680		probably benign	Het
Zfp780b	T	C	7: 27,963,468	Y554C	probably benign	Het
Zhx2	C	T	15: 57,821,280	T15I	probably damaging	Het

Other mutations in Grm8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Grm8	APN	6	27363801	missense	probably damaging	1.00
IGL01412:Grm8	APN	6	27762461	missense	probably damaging	1.00
IGL02329:Grm8	APN	6	27363116	missense	probably damaging	1.00
IGL02342:Grm8	APN	6	27363804	missense	probably benign	0.00
IGL02584:Grm8	APN	6	27762439	missense	probably benign	0.35
IGL03040:Grm8	APN	6	28126123	start codon destroyed	probably null	0.01
IGL03112:Grm8	APN	6	27363263	missense	probably damaging	1.00
IGL03139:Grm8	APN	6	27618650	missense	probably damaging	1.00
IGL03287:Grm8	APN	6	27760255	missense	possibly damaging	0.86
R0137:Grm8	UTSW	6	27762390	missense	probably damaging	0.99
R0266:Grm8	UTSW	6	27285896	missense	probably damaging	1.00
R0347:Grm8	UTSW	6	27981222	missense	probably benign	0.37
R0580:Grm8	UTSW	6	27761371	splice site	probably benign
R0698:Grm8	UTSW	6	27363914	missense	probably damaging	1.00
R0833:Grm8	UTSW	6	27363179	missense	probably damaging	1.00
R1301:Grm8	UTSW	6	27981201	missense	possibly damaging	0.94
R1323:Grm8	UTSW	6	28125974	missense	probably damaging	1.00
R1323:Grm8	UTSW	6	28125974	missense	probably damaging	1.00
R1471:Grm8	UTSW	6	27363309	missense	possibly damaging	0.79
R1554:Grm8	UTSW	6	28125853	missense	probably benign	0.01
R1638:Grm8	UTSW	6	28125883	nonsense	probably null
R1763:Grm8	UTSW	6	27285867	missense	possibly damaging	0.79
R1899:Grm8	UTSW	6	28125895	missense	probably damaging	1.00
R1902:Grm8	UTSW	6	27429482	missense	probably damaging	1.00
R1916:Grm8	UTSW	6	27363584	missense	probably benign	0.01
R2257:Grm8	UTSW	6	27760225	missense	probably damaging	0.98
R2351:Grm8	UTSW	6	28126119	missense	possibly damaging	0.66
R2396:Grm8	UTSW	6	27761242	missense	probably damaging	0.98
R3801:Grm8	UTSW	6	28125636	missense	possibly damaging	0.95
R3802:Grm8	UTSW	6	28125636	missense	possibly damaging	0.95
R3803:Grm8	UTSW	6	28125636	missense	possibly damaging	0.95
R3804:Grm8	UTSW	6	28125636	missense	possibly damaging	0.95
R3830:Grm8	UTSW	6	27761229	nonsense	probably null
R3844:Grm8	UTSW	6	27429508	missense	possibly damaging	0.69
R4006:Grm8	UTSW	6	27981230	missense	probably damaging	1.00
R4077:Grm8	UTSW	6	27760209	missense	probably benign	0.01
R4395:Grm8	UTSW	6	27429432	missense	probably damaging	0.98
R4436:Grm8	UTSW	6	27761238	missense	possibly damaging	0.48
R4810:Grm8	UTSW	6	27761296	missense	possibly damaging	0.87
R5357:Grm8	UTSW	6	27762419	missense	probably damaging	1.00
R5677:Grm8	UTSW	6	27761204	critical splice donor site	probably null
R5983:Grm8	UTSW	6	27760221	missense	probably benign	0.03
R5990:Grm8	UTSW	6	27363624	missense	probably damaging	1.00
R6365:Grm8	UTSW	6	27363227	missense	probably damaging	1.00
R6454:Grm8	UTSW	6	27363776	missense	possibly damaging	0.68
R6713:Grm8	UTSW	6	27363191	missense	probably damaging	1.00
R6960:Grm8	UTSW	6	27981282	missense	probably damaging	0.98
R7194:Grm8	UTSW	6	27618487	missense	probably benign	0.01
R7259:Grm8	UTSW	6	27760176	missense	probably null	0.99
R7305:Grm8	UTSW	6	27761355	missense	possibly damaging	0.51
R7421:Grm8	UTSW	6	27762477	missense	possibly damaging	0.66
R7561:Grm8	UTSW	6	27429525	missense	probably benign	0.44
R7605:Grm8	UTSW	6	27618679	missense	probably damaging	1.00
R7651:Grm8	UTSW	6	27760258	missense	possibly damaging	0.46
R7775:Grm8	UTSW	6	27363672	missense	possibly damaging	0.89
R7778:Grm8	UTSW	6	27363672	missense	possibly damaging	0.89
R7781:Grm8	UTSW	6	27285787	missense	probably benign
R7785:Grm8	UTSW	6	27618637	missense	probably damaging	0.99
R7898:Grm8	UTSW	6	27762423	missense	probably damaging	1.00
R8272:Grm8	UTSW	6	27363282	missense	probably damaging	1.00
R8274:Grm8	UTSW	6	27761336	missense	probably benign	0.31
R8501:Grm8	UTSW	6	27618541	missense	probably damaging	0.98
R8695:Grm8	UTSW	6	28126031	missense	probably benign	0.01
R8869:Grm8	UTSW	6	27363753	missense	probably benign	0.26
R9322:Grm8	UTSW	6	27363729	missense	possibly damaging	0.88
R9337:Grm8	UTSW	6	27761215	missense	probably benign	0.01
R9518:Grm8	UTSW	6	27429470	missense	probably benign	0.01
RF013:Grm8	UTSW	6	27363780	missense	probably damaging	1.00
Z1176:Grm8	UTSW	6	28126027	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- ACCAATAGTTTCACCTCTGAGC -3'
(R):5'- GGCCCACAATCCTGACTTATTC -3'

Sequencing Primer
(F):5'- GTTTCACCTCTGAGCTATGAATTTTG -3'
(R):5'- GCCCACAATCCTGACTTATTCAAATC -3'

Posted On

2021-07-15