Mutagenetix > Incidental Mutations

Incidental Mutation 'T0722:Casp1'

67333

Institutional Source

Beutler Lab

Gene Symbol

Casp1

Ensembl Gene

ENSMUSG00000025888

Gene Name

caspase 1

Synonyms

ICE, Il1bc, Caspase-1, interleukin 1 beta-converting enzyme

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

T0722 (G3) of strain 711

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

5298517-5307265 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 5299851 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 108 (H108L)

Ref Sequence

ENSEMBL: ENSMUSP00000027015 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027015]

AlphaFold

P29452

Predicted Effect

probably benign
Transcript: ENSMUST00000027015
AA Change: H108L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000027015
Gene: ENSMUSG00000025888
AA Change: H108L

Domain	Start	End	E-Value	Type
CARD	4	89	4.91e-19	SMART
CASc	151	400	1.82e-136	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.6%
20x: 95.5%

Validation Efficiency

95% (42/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce 2 subunits, large and small, that dimerize to form the active enzyme. This gene was identified by its ability to proteolytically cleave and activate the inactive precursor of interleukin-1, a cytokine involved in the processes such as inflammation, septic shock, and wound healing. This gene has been shown to induce cell apoptosis and may function in various developmental stages. Studies of a similar gene in mouse suggest a role in the pathogenesis of Huntington disease. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous targeted mutants fail to produce mature IL1A and IL1B and are resistant to LPS-induced endotoxin shock and to FAS antibody-induced apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam6b	A	G	12: 113,489,577	T5A	possibly damaging	Het
Adam6b	T	A	12: 113,491,268	D568E	probably benign	Het
Ago3	C	T	4: 126,404,263	V155I	probably benign	Het
Ago3	T	G	4: 126,404,296	T144P	probably benign	Het
Ago3	C	T	4: 126,404,305	A141T	probably benign	Het
Ago3	G	A	4: 126,404,310	A139V	probably benign	Het
Ahdc1	ACCTCCT	ACCTCCTCCT	4: 133,062,754		probably benign	Het
Atp6v1g3	T	A	1: 138,273,853		probably benign	Het
Azin2	A	G	4: 128,946,134	Y222H	probably benign	Het
Bicd2	C	A	13: 49,379,651	P571Q	probably benign	Het
Camta2	A	G	11: 70,684,005	I75T	probably damaging	Het
Cdk5r1	G	T	11: 80,477,881	V125F	probably benign	Het
Cherp	TTGGACCTGGACCTGGACCTGGACCTGGA	TTGGACCTGGACCTGGACCTGGA	8: 72,462,034		probably benign	Het
Cngb1	A	G	8: 95,296,650	M240T	probably benign	Het
Cngb1	G	T	8: 95,297,819	Q205K	probably damaging	Het
Cngb1	T	C	8: 95,303,696		probably benign	Het
Cngb1	G	A	8: 95,303,714		probably benign	Het
Cog8	G	T	8: 107,048,993	L580I	probably benign	Het
Copa	A	G	1: 172,111,948	E593G	possibly damaging	Het
Ctrc	T	TA	4: 141,845,196		probably null	Het
Cwf19l2	T	C	9: 3,456,755	F696S	probably benign	Het
Ddi2	G	A	4: 141,713,473		probably benign	Het
Eml5	T	C	12: 98,841,582	D984G	probably null	Het
Fam135b	T	G	15: 71,463,885	T487P	probably damaging	Het
Fstl3	A	G	10: 79,780,163	Y161C	probably damaging	Het
Gja4	G	C	4: 127,312,231	H246Q	probably benign	Het
Gm8186	C	T	17: 26,099,127	R32Q	probably benign	Het
Gm8394	A	G	10: 85,313,593		noncoding transcript	Het
Jakmip1	C	A	5: 37,118,903	A519D	probably damaging	Het
Jcad	G	T	18: 4,675,531	A1098S	probably benign	Het
Klhl14	T	C	18: 21,558,135	Y446C	probably damaging	Het
Lims1	A	G	10: 58,418,455	N344D	probably benign	Het
Marco	A	T	1: 120,474,712	W502R	probably damaging	Het
Mmp13	G	T	9: 7,280,857	M413I	possibly damaging	Het
Mmp25	G	A	17: 23,631,218	A456V	possibly damaging	Het
Msi2	A	T	11: 88,394,597	M207K	probably damaging	Het
Myh8	G	A	11: 67,304,436	R1692Q	probably benign	Het
Nbas	A	G	12: 13,352,808	I788V	probably benign	Het
Nup188	A	G	2: 30,322,681	D632G	probably damaging	Het
Olfr1141	T	A	2: 87,753,123	Y290F	probably damaging	Het
Olfr1219	A	G	2: 89,074,959	V44A	probably benign	Het
Olfr354	T	C	2: 36,907,570	V208A	probably benign	Het
Olfr360	T	G	2: 37,068,437	L44R	probably damaging	Het
Opa1	T	C	16: 29,610,930		probably null	Het
Pabpc1l	G	A	2: 164,042,420	G359D	possibly damaging	Het
Papd7	G	A	13: 69,506,955	R224*	probably null	Het
Plekhm2	TTCCTCCTCCT	TTCCTCCT	4: 141,631,981		probably benign	Het
Pomgnt1	C	T	4: 116,137,427		probably benign	Het
Qser1	A	G	2: 104,786,832	C1122R	possibly damaging	Het
Rfx8	A	G	1: 39,683,612	S282P	probably damaging	Het
Sec14l2	C	T	11: 4,103,673		probably null	Het
Sim2	C	A	16: 94,109,422	H228N	probably benign	Het
Slc15a2	A	G	16: 36,772,445	M179T	probably benign	Het
Slc30a6	T	A	17: 74,412,324		probably null	Het
Smarcc1	G	A	9: 110,206,085	E859K	possibly damaging	Het
Snx1	CTT	CTTGTT	9: 66,104,927		probably benign	Het
Spen	A	G	4: 141,474,353	V2321A	probably benign	Het
Spta1	A	G	1: 174,191,066		probably benign	Het
Sytl1	C	A	4: 133,256,851		probably benign	Het
Sytl1	A	G	4: 133,256,853		probably benign	Het
Terf2	T	C	8: 107,076,674	K425E	probably benign	Het
Tmem26	A	G	10: 68,778,718	E321G	probably benign	Het
Toe1	T	C	4: 116,806,093	I62M	probably benign	Het
Uck2	A	T	1: 167,234,711	D149E	probably benign	Het
Wnt5a	G	A	14: 28,511,925	A17T	probably benign	Het
Yif1b	T	C	7: 29,238,613		probably null	Het
Zbtb8a	GG	GGATG	4: 129,360,019		probably benign	Het
Zbtb8a	T	C	4: 129,360,212	H163R	probably benign	Het
Zkscan4	AGAGGAG	AGAG	13: 21,479,200		probably benign	Het
Zmym1	C	T	4: 127,047,947	D785N	probably benign	Het
Zmym1	C	T	4: 127,048,250	V684I	probably benign	Het
Zmym1	A	C	4: 127,049,673	H307Q	probably benign	Het

Other mutations in Casp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Casp1	APN	9	5299872	splice site	probably benign
IGL00667:Casp1	APN	9	5303756	missense	probably benign	0.40
IGL01998:Casp1	APN	9	5303043	missense	probably damaging	1.00
IGL02248:Casp1	APN	9	5299452	missense	probably benign	0.01
IGL02469:Casp1	APN	9	5303105	missense	probably benign	0.19
P0027:Casp1	UTSW	9	5299851	missense	probably benign	0.00
PIT4305001:Casp1	UTSW	9	5306135	missense	probably benign	0.03
R0724:Casp1	UTSW	9	5303077	missense	probably benign
R1169:Casp1	UTSW	9	5299454	missense	possibly damaging	0.93
R1876:Casp1	UTSW	9	5303663	missense	probably benign	0.01
R2316:Casp1	UTSW	9	5306213	missense	possibly damaging	0.92
R2877:Casp1	UTSW	9	5303110	missense	probably damaging	1.00
R2885:Casp1	UTSW	9	5299851	missense	probably benign	0.00
R4043:Casp1	UTSW	9	5302444	missense	probably benign
R4367:Casp1	UTSW	9	5299333	missense	probably benign	0.41
R4656:Casp1	UTSW	9	5304324	missense	probably damaging	1.00
R4705:Casp1	UTSW	9	5306204	missense	probably damaging	1.00
R4790:Casp1	UTSW	9	5303020	missense	probably benign	0.01
R4858:Casp1	UTSW	9	5306742	missense	probably damaging	1.00
R5607:Casp1	UTSW	9	5303143	missense	probably damaging	1.00
R5784:Casp1	UTSW	9	5299337	missense	probably damaging	0.98
R6578:Casp1	UTSW	9	5304280	missense	probably benign	0.04
R7111:Casp1	UTSW	9	5299816	missense	probably benign	0.01
R7215:Casp1	UTSW	9	5298523	splice site	probably null
R7590:Casp1	UTSW	9	5306710	missense	probably damaging	1.00
R8002:Casp1	UTSW	9	5303164	missense	possibly damaging	0.94
R8510:Casp1	UTSW	9	5303026	missense	probably damaging	1.00
R8902:Casp1	UTSW	9	5299333	missense	probably benign	0.41
R9234:Casp1	UTSW	9	5303128	missense	probably benign	0.04
X0003:Casp1	UTSW	9	5299851	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGAAGACTGCTACCTGGCAGGAA -3'
(R):5'- GGGGTTGTTCAGCTAAAATGTCCAGA -3'

Sequencing Primer
(F):5'- GAGCCTGAATCTTAGACCAAGTTG -3'
(R):5'- TAAGACTTGGACACAGACTCAG -3'

Posted On

2013-09-03