Incidental Mutation 'R8824:Smarca5'
ID 673333
Institutional Source Beutler Lab
Gene Symbol Smarca5
Ensembl Gene ENSMUSG00000031715
Gene Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5
Synonyms D330027N15Rik, 4933427E24Rik, D030040M08Rik, Snf2h, MommeD4
MMRRC Submission 068657-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8824 (G1)
Quality Score 204.009
Status Validated
Chromosome 8
Chromosomal Location 81426572-81466088 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 81431961 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 886 (F886L)
Ref Sequence ENSEMBL: ENSMUSP00000044361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043359]
AlphaFold Q91ZW3
Predicted Effect probably benign
Transcript: ENSMUST00000043359
AA Change: F886L

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: F886L

DomainStartEndE-ValueType
low complexity region 2 53 N/A INTRINSIC
Pfam:DBINO 65 112 1.1e-4 PFAM
low complexity region 145 156 N/A INTRINSIC
DEXDc 175 367 3.9e-46 SMART
Blast:DEXDc 386 421 6e-11 BLAST
HELICc 512 596 6.2e-28 SMART
low complexity region 756 768 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
SANT 840 889 2.3e-7 SMART
SANT 942 1006 3e-7 SMART
low complexity region 1008 1024 N/A INTRINSIC
Meta Mutation Damage Score 0.6559 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl A T 2: 93,693,195 (GRCm39) V260D probably damaging Het
Adora2a G A 10: 75,162,013 (GRCm39) A51T probably damaging Het
Afg1l G A 10: 42,314,383 (GRCm39) P128S possibly damaging Het
Ago4 C A 4: 126,400,977 (GRCm39) V623L probably benign Het
Akap11 A T 14: 78,753,787 (GRCm39) N112K Het
C1ra A T 6: 124,494,654 (GRCm39) I306F probably damaging Het
Ccdc73 A G 2: 104,822,222 (GRCm39) N724D possibly damaging Het
Cd248 A G 19: 5,119,645 (GRCm39) I498V probably benign Het
Clrn1 A T 3: 58,792,314 (GRCm39) S50T probably benign Het
Col7a1 A G 9: 108,796,093 (GRCm39) K1553R unknown Het
Cxcr6 A C 9: 123,640,006 (GRCm39) T343P probably benign Het
Cyp11b2 T A 15: 74,727,914 (GRCm39) Q56L probably damaging Het
Dip2a A G 10: 76,114,320 (GRCm39) probably null Het
Dnmbp A G 19: 43,838,276 (GRCm39) V742A probably benign Het
Dusp16 A T 6: 134,716,732 (GRCm39) S192T probably benign Het
Ehbp1 A T 11: 22,182,053 (GRCm39) D87E probably damaging Het
Fgl1 A G 8: 41,652,748 (GRCm39) V150A probably benign Het
Flt3 T C 5: 147,271,673 (GRCm39) D873G probably damaging Het
Gart T C 16: 91,427,591 (GRCm39) D469G possibly damaging Het
Gm28168 T G 1: 117,875,625 (GRCm39) S85A probably benign Het
Golgb1 A G 16: 36,736,051 (GRCm39) D1807G probably benign Het
Grm8 A G 6: 27,761,351 (GRCm39) L291S probably damaging Het
Gucy2d C T 7: 98,092,676 (GRCm39) P18S possibly damaging Het
Ifna15 C T 4: 88,475,998 (GRCm39) C162Y probably damaging Het
Iqub C A 6: 24,479,307 (GRCm39) E412* probably null Het
Krt4 T A 15: 101,829,077 (GRCm39) D312V Het
Krtap26-1 T C 16: 88,444,324 (GRCm39) Y99C probably damaging Het
Krtap26-1 A T 16: 88,444,303 (GRCm39) I106N probably damaging Het
Lipn T C 19: 34,062,116 (GRCm39) I357T probably benign Het
Lrrc14b A G 13: 74,512,068 (GRCm39) L4P probably damaging Het
Mrgpra9 A T 7: 46,885,041 (GRCm39) C209S probably benign Het
Myh7b A G 2: 155,472,301 (GRCm39) N1291D probably benign Het
Myo5a A G 9: 75,074,328 (GRCm39) T746A probably damaging Het
Myom2 A C 8: 15,164,169 (GRCm39) E1021D possibly damaging Het
Ncoa2 C T 1: 13,247,409 (GRCm39) R338H probably benign Het
Ncor2 A G 5: 125,195,821 (GRCm39) F91L Het
Neb C G 2: 52,106,923 (GRCm39) A4407P probably damaging Het
Or10u4 C T 10: 129,801,661 (GRCm39) V297M probably damaging Het
Or1j18 A T 2: 36,625,203 (GRCm39) Y290F probably damaging Het
Or4b1b A G 2: 90,126,356 (GRCm39) I283T probably damaging Het
Or5d47 A G 2: 87,804,347 (GRCm39) F221L probably benign Het
Or5p76 T G 7: 108,122,350 (GRCm39) Y269S probably benign Het
Or5w12 T C 2: 87,502,304 (GRCm39) M136V possibly damaging Het
Peg10 T TCCC 6: 4,756,451 (GRCm39) probably benign Het
Piwil4 C A 9: 14,638,771 (GRCm39) K298N probably benign Het
Prkcz G A 4: 155,429,285 (GRCm39) probably benign Het
Prkg2 G A 5: 99,090,067 (GRCm39) P691L possibly damaging Het
Ptprc T A 1: 138,041,446 (GRCm39) K89* probably null Het
Rapgef3 C T 15: 97,664,789 (GRCm39) A25T probably benign Het
Rreb1 C T 13: 38,114,492 (GRCm39) T617I probably damaging Het
Rsph1 A C 17: 31,492,350 (GRCm39) V72G possibly damaging Het
Shc2 A G 10: 79,473,536 (GRCm39) V50A probably benign Het
Slc38a9 G A 13: 112,838,021 (GRCm39) R262H probably benign Het
Slco6c1 T A 1: 97,055,884 (GRCm39) N6Y possibly damaging Het
Tas1r2 A G 4: 139,381,074 (GRCm39) probably benign Het
Tnrc6c T A 11: 117,630,680 (GRCm39) probably benign Het
Trim30b T A 7: 104,007,113 (GRCm39) probably benign Het
Trim55 T C 3: 19,727,126 (GRCm39) S398P probably benign Het
Ttc39c T A 18: 12,820,003 (GRCm39) probably benign Het
Ubxn10 A G 4: 138,463,178 (GRCm39) probably null Het
Usf3 A G 16: 44,035,976 (GRCm39) N152S probably benign Het
Vps13b T A 15: 35,533,445 (GRCm39) V839E probably damaging Het
Zeb1 T A 18: 5,748,680 (GRCm39) probably benign Het
Zfp780b T C 7: 27,662,893 (GRCm39) Y554C probably benign Het
Zhx2 C T 15: 57,684,676 (GRCm39) T15I probably damaging Het
Other mutations in Smarca5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Smarca5 APN 8 81,440,670 (GRCm39) missense probably benign 0.10
IGL01138:Smarca5 APN 8 81,427,705 (GRCm39) missense possibly damaging 0.87
IGL01290:Smarca5 APN 8 81,454,277 (GRCm39) missense probably benign
IGL02338:Smarca5 APN 8 81,446,199 (GRCm39) splice site probably benign
IGL03212:Smarca5 APN 8 81,438,410 (GRCm39) missense possibly damaging 0.47
IGL03216:Smarca5 APN 8 81,446,287 (GRCm39) missense probably damaging 1.00
Cipher UTSW 8 81,446,281 (GRCm39) missense probably damaging 1.00
Codebook UTSW 8 81,460,336 (GRCm39) missense probably benign
Codex UTSW 8 81,437,192 (GRCm39) missense probably damaging 0.99
Encryption UTSW 8 81,431,355 (GRCm39) missense probably damaging 1.00
Enigma UTSW 8 81,431,961 (GRCm39) missense probably benign 0.35
Key UTSW 8 81,452,680 (GRCm39) missense probably damaging 1.00
Sailor UTSW 8 81,463,355 (GRCm39) missense probably benign 0.07
Soldier UTSW 8 81,446,344 (GRCm39) missense probably damaging 1.00
tinker UTSW 8 81,460,379 (GRCm39) missense probably benign
R0254:Smarca5 UTSW 8 81,431,329 (GRCm39) missense probably benign 0.05
R0374:Smarca5 UTSW 8 81,463,360 (GRCm39) missense probably benign 0.30
R0625:Smarca5 UTSW 8 81,447,315 (GRCm39) critical splice donor site probably null
R1065:Smarca5 UTSW 8 81,431,343 (GRCm39) missense probably damaging 1.00
R1164:Smarca5 UTSW 8 81,437,260 (GRCm39) missense probably damaging 1.00
R1709:Smarca5 UTSW 8 81,435,849 (GRCm39) nonsense probably null
R2102:Smarca5 UTSW 8 81,431,304 (GRCm39) missense probably damaging 1.00
R3831:Smarca5 UTSW 8 81,455,123 (GRCm39) missense probably damaging 0.99
R4625:Smarca5 UTSW 8 81,437,192 (GRCm39) missense probably damaging 0.99
R4750:Smarca5 UTSW 8 81,460,336 (GRCm39) missense probably benign
R4822:Smarca5 UTSW 8 81,435,309 (GRCm39) splice site probably null
R4889:Smarca5 UTSW 8 81,431,326 (GRCm39) missense possibly damaging 0.95
R5756:Smarca5 UTSW 8 81,437,233 (GRCm39) missense probably benign
R6120:Smarca5 UTSW 8 81,438,372 (GRCm39) missense probably damaging 0.98
R6582:Smarca5 UTSW 8 81,446,281 (GRCm39) missense probably damaging 1.00
R6939:Smarca5 UTSW 8 81,431,949 (GRCm39) missense possibly damaging 0.63
R6972:Smarca5 UTSW 8 81,431,380 (GRCm39) missense probably damaging 1.00
R6973:Smarca5 UTSW 8 81,431,380 (GRCm39) missense probably damaging 1.00
R7027:Smarca5 UTSW 8 81,463,355 (GRCm39) missense probably benign 0.07
R7376:Smarca5 UTSW 8 81,452,680 (GRCm39) missense probably damaging 1.00
R7514:Smarca5 UTSW 8 81,444,163 (GRCm39) missense probably damaging 1.00
R7962:Smarca5 UTSW 8 81,463,388 (GRCm39) missense probably benign
R8031:Smarca5 UTSW 8 81,431,311 (GRCm39) missense probably damaging 1.00
R8400:Smarca5 UTSW 8 81,435,756 (GRCm39) missense probably benign 0.02
R8798:Smarca5 UTSW 8 81,443,137 (GRCm39) missense probably damaging 1.00
R8817:Smarca5 UTSW 8 81,460,379 (GRCm39) missense probably benign
R8905:Smarca5 UTSW 8 81,440,577 (GRCm39) missense probably benign 0.14
R9018:Smarca5 UTSW 8 81,431,355 (GRCm39) missense probably damaging 1.00
R9028:Smarca5 UTSW 8 81,440,642 (GRCm39) missense probably damaging 1.00
R9203:Smarca5 UTSW 8 81,431,258 (GRCm39) nonsense probably null
R9253:Smarca5 UTSW 8 81,446,344 (GRCm39) missense probably damaging 1.00
R9294:Smarca5 UTSW 8 81,446,432 (GRCm39) missense probably damaging 1.00
R9328:Smarca5 UTSW 8 81,447,378 (GRCm39) missense probably benign 0.00
R9396:Smarca5 UTSW 8 81,463,358 (GRCm39) missense probably benign 0.00
R9514:Smarca5 UTSW 8 81,428,840 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGTCTTCTTTAAACCAGGC -3'
(R):5'- TTTATCAAGGCTAATGAGAAGTGGG -3'

Sequencing Primer
(F):5'- ACCAGGCTAACAATTTAATATTCAGG -3'
(R):5'- CTAATGAGAAGTGGGGTCGTG -3'
Posted On 2021-07-15