Incidental Mutation 'R8824:Adora2a'
ID 673339
Institutional Source Beutler Lab
Gene Symbol Adora2a
Ensembl Gene ENSMUSG00000020178
Gene Name adenosine A2a receptor
Synonyms A2AAR, AA2AR, A2aR, A2a, Rs
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8824 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 75316877-75334784 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 75326179 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 51 (A51T)
Ref Sequence ENSEMBL: ENSMUSP00000101060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105420] [ENSMUST00000217703] [ENSMUST00000219044] [ENSMUST00000219322]
AlphaFold Q60613
Predicted Effect probably damaging
Transcript: ENSMUST00000105420
AA Change: A51T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101060
Gene: ENSMUSG00000020178
AA Change: A51T

DomainStartEndE-ValueType
Pfam:7tm_4 11 301 1.9e-9 PFAM
Pfam:7TM_GPCR_Srsx 14 298 5.1e-15 PFAM
Pfam:7tm_1 20 283 3.1e-62 PFAM
low complexity region 355 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217703
Predicted Effect probably damaging
Transcript: ENSMUST00000219044
AA Change: A51T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000219322
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily, which is subdivided into classes and subtypes. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein, an adenosine receptor of A2A subtype, uses adenosine as the preferred endogenous agonist and preferentially interacts with the G(s) and G(olf) family of G proteins to increase intracellular cAMP levels. It plays an important role in many biological functions, such as cardiac rhythm and circulation, cerebral and renal blood flow, immune function, pain regulation, and sleep. It has been implicated in pathophysiological conditions such as inflammatory diseases and neurodegenerative disorders. Alternative splicing results in multiple transcript variants. A read-through transcript composed of the upstream SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are viable and fertile with reduced exploratory activity and displaying depressive rather than stimulatory response to caffeine. Mutants test more anxious, were more aggressive towards intruders, and slower to respond to pain stimuli. Blood pressure and heart rate are increased, as well as platelet aggregation rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl A T 2: 93,862,850 V260D probably damaging Het
Afg1l G A 10: 42,438,387 P128S possibly damaging Het
Ago4 C A 4: 126,507,184 V623L probably benign Het
Akap11 A T 14: 78,516,347 N112K Het
C1ra A T 6: 124,517,695 I306F probably damaging Het
Ccdc73 A G 2: 104,991,877 N724D possibly damaging Het
Cd248 A G 19: 5,069,617 I498V probably benign Het
Clrn1 A T 3: 58,884,893 S50T probably benign Het
Col7a1 A G 9: 108,967,025 K1553R unknown Het
Cxcr6 A C 9: 123,810,941 T343P probably benign Het
Cyp11b2 T A 15: 74,856,065 Q56L probably damaging Het
Dip2a A G 10: 76,278,486 probably null Het
Dnmbp A G 19: 43,849,837 V742A probably benign Het
Dusp16 A T 6: 134,739,769 S192T probably benign Het
Ehbp1 A T 11: 22,232,053 D87E probably damaging Het
Fgl1 A G 8: 41,199,711 V150A probably benign Het
Flt3 T C 5: 147,334,863 D873G probably damaging Het
Gart T C 16: 91,630,703 D469G possibly damaging Het
Gm28168 T G 1: 117,947,895 S85A probably benign Het
Golgb1 A G 16: 36,915,689 D1807G probably benign Het
Grm8 A G 6: 27,761,352 L291S probably damaging Het
Gucy2d C T 7: 98,443,469 P18S possibly damaging Het
Ifna15 C T 4: 88,557,761 C162Y probably damaging Het
Iqub C A 6: 24,479,308 E412* probably null Het
Krt4 T A 15: 101,920,642 D312V Het
Krtap26-1 A T 16: 88,647,415 I106N probably damaging Het
Krtap26-1 T C 16: 88,647,436 Y99C probably damaging Het
Lipn T C 19: 34,084,716 I357T probably benign Het
Lrrc14b A G 13: 74,363,949 L4P probably damaging Het
Mrgpra9 A T 7: 47,235,293 C209S probably benign Het
Myh7b A G 2: 155,630,381 N1291D probably benign Het
Myo5a A G 9: 75,167,046 T746A probably damaging Het
Myom2 A C 8: 15,114,169 E1021D possibly damaging Het
Ncoa2 C T 1: 13,177,185 R338H probably benign Het
Ncor2 A G 5: 125,118,757 F91L Het
Neb C G 2: 52,216,911 A4407P probably damaging Het
Olfr1135 T C 2: 87,671,960 M136V possibly damaging Het
Olfr1272 A G 2: 90,296,012 I283T probably damaging Het
Olfr347 A T 2: 36,735,191 Y290F probably damaging Het
Olfr502 T G 7: 108,523,143 Y269S probably benign Het
Olfr74 A G 2: 87,974,003 F221L probably benign Het
Olfr819 C T 10: 129,965,792 V297M probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Piwil4 C A 9: 14,727,475 K298N probably benign Het
Prkcz G A 4: 155,344,828 probably benign Het
Prkg2 G A 5: 98,942,208 P691L possibly damaging Het
Ptprc T A 1: 138,113,708 K89* probably null Het
Rapgef3 C T 15: 97,766,908 A25T probably benign Het
Rreb1 C T 13: 37,930,516 T617I probably damaging Het
Rsph1 A C 17: 31,273,376 V72G possibly damaging Het
Shc2 A G 10: 79,637,702 V50A probably benign Het
Slc38a9 G A 13: 112,701,487 R262H probably benign Het
Slco6c1 T A 1: 97,128,159 N6Y possibly damaging Het
Smarca5 A G 8: 80,705,332 F886L probably benign Het
Tas1r2 A G 4: 139,653,763 probably benign Het
Tnrc6c T A 11: 117,739,854 probably benign Het
Trim30b T A 7: 104,357,906 probably benign Het
Trim55 T C 3: 19,672,962 S398P probably benign Het
Ttc39c T A 18: 12,686,946 probably benign Het
Ubxn10 A G 4: 138,735,867 probably null Het
Usf3 A G 16: 44,215,613 N152S probably benign Het
Vps13b T A 15: 35,533,299 V839E probably damaging Het
Zeb1 T A 18: 5,748,680 probably benign Het
Zfp780b T C 7: 27,963,468 Y554C probably benign Het
Zhx2 C T 15: 57,821,280 T15I probably damaging Het
Other mutations in Adora2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Adora2a APN 10 75333451 missense probably damaging 0.99
IGL01298:Adora2a APN 10 75333492 missense probably damaging 1.00
R1217:Adora2a UTSW 10 75333215 missense probably damaging 1.00
R1983:Adora2a UTSW 10 75333646 missense probably benign 0.04
R2329:Adora2a UTSW 10 75326183 missense probably damaging 1.00
R4808:Adora2a UTSW 10 75333446 missense probably damaging 1.00
R4884:Adora2a UTSW 10 75326045 missense probably null 0.99
R5056:Adora2a UTSW 10 75326158 missense probably damaging 1.00
R5250:Adora2a UTSW 10 75326048 missense probably damaging 1.00
R6153:Adora2a UTSW 10 75326147 missense possibly damaging 0.78
R6306:Adora2a UTSW 10 75333404 missense probably damaging 1.00
R6746:Adora2a UTSW 10 75333608 missense probably benign 0.12
R7047:Adora2a UTSW 10 75326311 missense probably damaging 1.00
R7493:Adora2a UTSW 10 75333589 missense possibly damaging 0.92
R7792:Adora2a UTSW 10 75333646 missense probably benign 0.00
R8941:Adora2a UTSW 10 75333725 nonsense probably null
RF004:Adora2a UTSW 10 75333154 missense probably benign 0.00
X0017:Adora2a UTSW 10 75333563 missense probably damaging 1.00
Z1176:Adora2a UTSW 10 75333328 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCTTGTGAGGAAAGGGCTG -3'
(R):5'- TATGCACAGATGTAACCCCTGG -3'

Sequencing Primer
(F):5'- CAGCTATGGACCGAGAGCTG -3'
(R):5'- TGGCTCACCGGAGTGGAATTC -3'
Posted On 2021-07-15