Mutagenetix > Incidental Mutation

Incidental Mutation 'R8824:Akap11'

673347

Institutional Source

Beutler Lab

Gene Symbol

Akap11

Ensembl Gene

ENSMUSG00000022016

Gene Name

A kinase (PRKA) anchor protein 11

Synonyms

6330501D17Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8824 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

78492246-78536808 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 78516347 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 112 (N112K)

Ref Sequence

ENSEMBL: ENSMUSP00000022593 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022593] [ENSMUST00000123853]

AlphaFold

E9Q777

Predicted Effect

SMART Domains

Protein: ENSMUSP00000022593
Gene: ENSMUSG00000022016
AA Change: N112K

Domain	Start	End	E-Value	Type
low complexity region	108	121	N/A	INTRINSIC
low complexity region	170	179	N/A	INTRINSIC
low complexity region	265	275	N/A	INTRINSIC
low complexity region	302	318	N/A	INTRINSIC
low complexity region	344	365	N/A	INTRINSIC
low complexity region	528	539	N/A	INTRINSIC
low complexity region	609	623	N/A	INTRINSIC
low complexity region	727	741	N/A	INTRINSIC
low complexity region	1161	1173	N/A	INTRINSIC
low complexity region	1597	1614	N/A	INTRINSIC
low complexity region	1631	1648	N/A	INTRINSIC
low complexity region	1738	1755	N/A	INTRINSIC
low complexity region	1767	1788	N/A	INTRINSIC
Blast:AKAP_110	1790	1883	2e-8	BLAST

Predicted Effect

SMART Domains

Protein: ENSMUSP00000116015
Gene: ENSMUSG00000022016
AA Change: N112K

Domain	Start	End	E-Value	Type
low complexity region	108	121	N/A	INTRINSIC
low complexity region	170	179	N/A	INTRINSIC
low complexity region	265	275	N/A	INTRINSIC
low complexity region	302	318	N/A	INTRINSIC
low complexity region	344	365	N/A	INTRINSIC
low complexity region	528	539	N/A	INTRINSIC
low complexity region	609	623	N/A	INTRINSIC
low complexity region	727	741	N/A	INTRINSIC
low complexity region	1161	1173	N/A	INTRINSIC
low complexity region	1597	1614	N/A	INTRINSIC
low complexity region	1631	1648	N/A	INTRINSIC
low complexity region	1731	1756	N/A	INTRINSIC
low complexity region	1768	1789	N/A	INTRINSIC
Blast:AKAP_110	1791	1884	2e-8	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is expressed at high levels throughout spermatogenesis and in mature sperm. It binds the RI and RII subunits of PKA in testis. It may serve a function in cell cycle control of both somatic cells and germ cells in addition to its putative role in spermatogenesis and sperm function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show a reduction in body size, body length and tibia length, hypoactivity, slow movement and increased anxiety-related responses, and exhibit actin barrier defects in kidney collecting duct cells and increased urine osmolality in response to overhydration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Accsl	A	T	2: 93,862,850	V260D	probably damaging	Het
Adora2a	G	A	10: 75,326,179	A51T	probably damaging	Het
Afg1l	G	A	10: 42,438,387	P128S	possibly damaging	Het
Ago4	C	A	4: 126,507,184	V623L	probably benign	Het
C1ra	A	T	6: 124,517,695	I306F	probably damaging	Het
Ccdc73	A	G	2: 104,991,877	N724D	possibly damaging	Het
Cd248	A	G	19: 5,069,617	I498V	probably benign	Het
Clrn1	A	T	3: 58,884,893	S50T	probably benign	Het
Col7a1	A	G	9: 108,967,025	K1553R	unknown	Het
Cxcr6	A	C	9: 123,810,941	T343P	probably benign	Het
Cyp11b2	T	A	15: 74,856,065	Q56L	probably damaging	Het
Dip2a	A	G	10: 76,278,486		probably null	Het
Dnmbp	A	G	19: 43,849,837	V742A	probably benign	Het
Dusp16	A	T	6: 134,739,769	S192T	probably benign	Het
Ehbp1	A	T	11: 22,232,053	D87E	probably damaging	Het
Fgl1	A	G	8: 41,199,711	V150A	probably benign	Het
Flt3	T	C	5: 147,334,863	D873G	probably damaging	Het
Gart	T	C	16: 91,630,703	D469G	possibly damaging	Het
Gm28168	T	G	1: 117,947,895	S85A	probably benign	Het
Golgb1	A	G	16: 36,915,689	D1807G	probably benign	Het
Grm8	A	G	6: 27,761,352	L291S	probably damaging	Het
Gucy2d	C	T	7: 98,443,469	P18S	possibly damaging	Het
Ifna15	C	T	4: 88,557,761	C162Y	probably damaging	Het
Iqub	C	A	6: 24,479,308	E412*	probably null	Het
Krt4	T	A	15: 101,920,642	D312V		Het
Krtap26-1	A	T	16: 88,647,415	I106N	probably damaging	Het
Krtap26-1	T	C	16: 88,647,436	Y99C	probably damaging	Het
Lipn	T	C	19: 34,084,716	I357T	probably benign	Het
Lrrc14b	A	G	13: 74,363,949	L4P	probably damaging	Het
Mrgpra9	A	T	7: 47,235,293	C209S	probably benign	Het
Myh7b	A	G	2: 155,630,381	N1291D	probably benign	Het
Myo5a	A	G	9: 75,167,046	T746A	probably damaging	Het
Myom2	A	C	8: 15,114,169	E1021D	possibly damaging	Het
Ncoa2	C	T	1: 13,177,185	R338H	probably benign	Het
Ncor2	A	G	5: 125,118,757	F91L		Het
Neb	C	G	2: 52,216,911	A4407P	probably damaging	Het
Olfr1135	T	C	2: 87,671,960	M136V	possibly damaging	Het
Olfr1272	A	G	2: 90,296,012	I283T	probably damaging	Het
Olfr347	A	T	2: 36,735,191	Y290F	probably damaging	Het
Olfr502	T	G	7: 108,523,143	Y269S	probably benign	Het
Olfr74	A	G	2: 87,974,003	F221L	probably benign	Het
Olfr819	C	T	10: 129,965,792	V297M	probably damaging	Het
Peg10	T	TCCC	6: 4,756,451		probably benign	Het
Piwil4	C	A	9: 14,727,475	K298N	probably benign	Het
Prkcz	G	A	4: 155,344,828		probably benign	Het
Prkg2	G	A	5: 98,942,208	P691L	possibly damaging	Het
Ptprc	T	A	1: 138,113,708	K89*	probably null	Het
Rapgef3	C	T	15: 97,766,908	A25T	probably benign	Het
Rreb1	C	T	13: 37,930,516	T617I	probably damaging	Het
Rsph1	A	C	17: 31,273,376	V72G	possibly damaging	Het
Shc2	A	G	10: 79,637,702	V50A	probably benign	Het
Slc38a9	G	A	13: 112,701,487	R262H	probably benign	Het
Slco6c1	T	A	1: 97,128,159	N6Y	possibly damaging	Het
Smarca5	A	G	8: 80,705,332	F886L	probably benign	Het
Tas1r2	A	G	4: 139,653,763		probably benign	Het
Tnrc6c	T	A	11: 117,739,854		probably benign	Het
Trim30b	T	A	7: 104,357,906		probably benign	Het
Trim55	T	C	3: 19,672,962	S398P	probably benign	Het
Ttc39c	T	A	18: 12,686,946		probably benign	Het
Ubxn10	A	G	4: 138,735,867		probably null	Het
Usf3	A	G	16: 44,215,613	N152S	probably benign	Het
Vps13b	T	A	15: 35,533,299	V839E	probably damaging	Het
Zeb1	T	A	18: 5,748,680		probably benign	Het
Zfp780b	T	C	7: 27,963,468	Y554C	probably benign	Het
Zhx2	C	T	15: 57,821,280	T15I	probably damaging	Het

Other mutations in Akap11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00672:Akap11	APN	14	78511341	missense	probably damaging	1.00
IGL00902:Akap11	APN	14	78495838	missense	probably benign	0.11
IGL01752:Akap11	APN	14	78509878	critical splice donor site	probably null
IGL01972:Akap11	APN	14	78507857	missense	probably damaging	0.99
IGL02031:Akap11	APN	14	78513813	missense	possibly damaging	0.50
IGL02239:Akap11	APN	14	78513849	missense	probably damaging	1.00
IGL02528:Akap11	APN	14	78510867	missense	probably damaging	1.00
IGL02884:Akap11	APN	14	78498962	missense	probably benign	0.02
IGL03130:Akap11	APN	14	78510368	nonsense	probably null
IGL03179:Akap11	APN	14	78507740	missense	probably benign	0.00
IGL03240:Akap11	APN	14	78495905	missense	probably damaging	0.99
IGL03331:Akap11	APN	14	78513865	missense	probably damaging	1.00
bonham	UTSW	14	78498864	nonsense	probably null
R0004:Akap11	UTSW	14	78514940	missense	possibly damaging	0.65
R0020:Akap11	UTSW	14	78518177	missense	probably benign	0.37
R0200:Akap11	UTSW	14	78510753	missense	probably benign	0.00
R0281:Akap11	UTSW	14	78510089	missense	possibly damaging	0.84
R0320:Akap11	UTSW	14	78513379	missense	probably benign
R0381:Akap11	UTSW	14	78513550	missense	probably benign	0.01
R0536:Akap11	UTSW	14	78514024	missense	probably damaging	1.00
R0608:Akap11	UTSW	14	78510753	missense	probably benign	0.00
R0735:Akap11	UTSW	14	78510078	missense	probably damaging	1.00
R1189:Akap11	UTSW	14	78513347	missense	probably benign	0.11
R1400:Akap11	UTSW	14	78513962	missense	probably damaging	1.00
R1406:Akap11	UTSW	14	78512749	missense	probably benign
R1406:Akap11	UTSW	14	78512749	missense	probably benign
R1501:Akap11	UTSW	14	78513347	missense	probably benign	0.11
R1588:Akap11	UTSW	14	78510245	missense	possibly damaging	0.50
R1717:Akap11	UTSW	14	78513348	missense	probably benign	0.02
R1823:Akap11	UTSW	14	78511488	missense	probably damaging	1.00
R1847:Akap11	UTSW	14	78513661	missense	probably benign	0.00
R1874:Akap11	UTSW	14	78511866	missense	probably benign	0.14
R2031:Akap11	UTSW	14	78510037	missense	possibly damaging	0.86
R2032:Akap11	UTSW	14	78510037	missense	possibly damaging	0.86
R2276:Akap11	UTSW	14	78510037	missense	possibly damaging	0.86
R2763:Akap11	UTSW	14	78518892	missense	probably damaging	0.98
R4483:Akap11	UTSW	14	78510259	missense	probably damaging	1.00
R4582:Akap11	UTSW	14	78511929	missense	possibly damaging	0.81
R4857:Akap11	UTSW	14	78498860	missense
R4922:Akap11	UTSW	14	78512780	nonsense	probably null
R4993:Akap11	UTSW	14	78512968	missense	probably damaging	1.00
R5426:Akap11	UTSW	14	78498864	nonsense	probably null
R5472:Akap11	UTSW	14	78513429	missense	probably benign	0.03
R5683:Akap11	UTSW	14	78512578	missense	probably damaging	0.98
R5774:Akap11	UTSW	14	78510967	missense	probably damaging	1.00
R6014:Akap11	UTSW	14	78512499	missense	probably benign	0.00
R6264:Akap11	UTSW	14	78512421	missense	possibly damaging	0.68
R6270:Akap11	UTSW	14	78518799	missense	probably damaging	1.00
R6319:Akap11	UTSW	14	78513538	missense	probably benign	0.06
R6376:Akap11	UTSW	14	78514896	missense	probably damaging	1.00
R6394:Akap11	UTSW	14	78522589	critical splice donor site	probably null
R6536:Akap11	UTSW	14	78511314	missense	possibly damaging	0.81
R7048:Akap11	UTSW	14	78512514	missense
R7147:Akap11	UTSW	14	78511465	missense
R7473:Akap11	UTSW	14	78513888	missense
R7503:Akap11	UTSW	14	78512001	missense
R7542:Akap11	UTSW	14	78510292	missense
R7618:Akap11	UTSW	14	78498860	missense
R7679:Akap11	UTSW	14	78514816	missense
R7973:Akap11	UTSW	14	78515066	missense
R8094:Akap11	UTSW	14	78512973	missense
R8098:Akap11	UTSW	14	78512922	missense
R8226:Akap11	UTSW	14	78511209	missense
R8269:Akap11	UTSW	14	78513378	missense
R8304:Akap11	UTSW	14	78513232	missense
R8343:Akap11	UTSW	14	78512489	missense
R8389:Akap11	UTSW	14	78518882	missense
R9034:Akap11	UTSW	14	78510859	missense
R9189:Akap11	UTSW	14	78513498	missense
R9259:Akap11	UTSW	14	78512509	missense
R9275:Akap11	UTSW	14	78513709	missense
R9434:Akap11	UTSW	14	78510389	missense
R9500:Akap11	UTSW	14	78511103	missense

Predicted Primers

PCR Primer
(F):5'- TTCAAGGCTGGCAATGCTTTG -3'
(R):5'- GTGAGCTGTTACAAAGCAGAC -3'

Sequencing Primer
(F):5'- CTGGCAATGCTTTGTGAGTTAGAC -3'
(R):5'- TGGACAACATTGTGGAAACCTTGAC -3'

Posted On

2021-07-15