Incidental Mutation 'R8824:Cyp11b2'
ID 673350
Institutional Source Beutler Lab
Gene Symbol Cyp11b2
Ensembl Gene ENSMUSG00000022589
Gene Name cytochrome P450, family 11, subfamily b, polypeptide 2
Synonyms Cyp11b-2, Cyp11b, aldosterone synthase, steroid-11-beta-hydroxylase
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock # R8824 (G1)
Quality Score 179.009
Status Not validated
Chromosome 15
Chromosomal Location 74851010-74856318 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 74856065 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 56 (Q56L)
Ref Sequence ENSEMBL: ENSMUSP00000131503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167634]
AlphaFold P15539
Predicted Effect probably damaging
Transcript: ENSMUST00000167634
AA Change: Q56L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131503
Gene: ENSMUSG00000022589
AA Change: Q56L

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Pfam:p450 44 498 1e-115 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane and is involved in the conversion of progesterone to cortisol in the adrenal cortex. Mutations in this gene cause congenital adrenal hyperplasia due to 11-beta-hydroxylase deficiency. Transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some postnatal lethality, altered blood chemistry, hypotension, and abnormal adrenal cortex morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl A T 2: 93,862,850 V260D probably damaging Het
Adora2a G A 10: 75,326,179 A51T probably damaging Het
Afg1l G A 10: 42,438,387 P128S possibly damaging Het
Ago4 C A 4: 126,507,184 V623L probably benign Het
Akap11 A T 14: 78,516,347 N112K Het
C1ra A T 6: 124,517,695 I306F probably damaging Het
Ccdc73 A G 2: 104,991,877 N724D possibly damaging Het
Cd248 A G 19: 5,069,617 I498V probably benign Het
Clrn1 A T 3: 58,884,893 S50T probably benign Het
Col7a1 A G 9: 108,967,025 K1553R unknown Het
Cxcr6 A C 9: 123,810,941 T343P probably benign Het
Dip2a A G 10: 76,278,486 probably null Het
Dnmbp A G 19: 43,849,837 V742A probably benign Het
Dusp16 A T 6: 134,739,769 S192T probably benign Het
Ehbp1 A T 11: 22,232,053 D87E probably damaging Het
Fgl1 A G 8: 41,199,711 V150A probably benign Het
Flt3 T C 5: 147,334,863 D873G probably damaging Het
Gart T C 16: 91,630,703 D469G possibly damaging Het
Gm28168 T G 1: 117,947,895 S85A probably benign Het
Golgb1 A G 16: 36,915,689 D1807G probably benign Het
Grm8 A G 6: 27,761,352 L291S probably damaging Het
Gucy2d C T 7: 98,443,469 P18S possibly damaging Het
Ifna15 C T 4: 88,557,761 C162Y probably damaging Het
Iqub C A 6: 24,479,308 E412* probably null Het
Krt4 T A 15: 101,920,642 D312V Het
Krtap26-1 A T 16: 88,647,415 I106N probably damaging Het
Krtap26-1 T C 16: 88,647,436 Y99C probably damaging Het
Lipn T C 19: 34,084,716 I357T probably benign Het
Lrrc14b A G 13: 74,363,949 L4P probably damaging Het
Mrgpra9 A T 7: 47,235,293 C209S probably benign Het
Myh7b A G 2: 155,630,381 N1291D probably benign Het
Myo5a A G 9: 75,167,046 T746A probably damaging Het
Myom2 A C 8: 15,114,169 E1021D possibly damaging Het
Ncoa2 C T 1: 13,177,185 R338H probably benign Het
Ncor2 A G 5: 125,118,757 F91L Het
Neb C G 2: 52,216,911 A4407P probably damaging Het
Olfr1135 T C 2: 87,671,960 M136V possibly damaging Het
Olfr1272 A G 2: 90,296,012 I283T probably damaging Het
Olfr347 A T 2: 36,735,191 Y290F probably damaging Het
Olfr502 T G 7: 108,523,143 Y269S probably benign Het
Olfr74 A G 2: 87,974,003 F221L probably benign Het
Olfr819 C T 10: 129,965,792 V297M probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Piwil4 C A 9: 14,727,475 K298N probably benign Het
Prkcz G A 4: 155,344,828 probably benign Het
Prkg2 G A 5: 98,942,208 P691L possibly damaging Het
Ptprc T A 1: 138,113,708 K89* probably null Het
Rapgef3 C T 15: 97,766,908 A25T probably benign Het
Rreb1 C T 13: 37,930,516 T617I probably damaging Het
Rsph1 A C 17: 31,273,376 V72G possibly damaging Het
Shc2 A G 10: 79,637,702 V50A probably benign Het
Slc38a9 G A 13: 112,701,487 R262H probably benign Het
Slco6c1 T A 1: 97,128,159 N6Y possibly damaging Het
Smarca5 A G 8: 80,705,332 F886L probably benign Het
Tas1r2 A G 4: 139,653,763 probably benign Het
Tnrc6c T A 11: 117,739,854 probably benign Het
Trim30b T A 7: 104,357,906 probably benign Het
Trim55 T C 3: 19,672,962 S398P probably benign Het
Ttc39c T A 18: 12,686,946 probably benign Het
Ubxn10 A G 4: 138,735,867 probably null Het
Usf3 A G 16: 44,215,613 N152S probably benign Het
Vps13b T A 15: 35,533,299 V839E probably damaging Het
Zeb1 T A 18: 5,748,680 probably benign Het
Zfp780b T C 7: 27,963,468 Y554C probably benign Het
Zhx2 C T 15: 57,821,280 T15I probably damaging Het
Other mutations in Cyp11b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Cyp11b2 APN 15 74853515 missense probably benign 0.00
IGL02058:Cyp11b2 APN 15 74853189 missense probably benign 0.30
IGL02419:Cyp11b2 APN 15 74851055 missense probably damaging 1.00
IGL03094:Cyp11b2 APN 15 74853037 critical splice donor site probably null
IGL03237:Cyp11b2 APN 15 74851065 missense probably benign 0.00
Spargel UTSW 15 74851432 missense probably damaging 1.00
stickfigure UTSW 15 74851570 missense possibly damaging 0.46
Stringbean UTSW 15 74853130 missense probably damaging 1.00
veronica UTSW 15 74853991 missense probably damaging 1.00
PIT4243001:Cyp11b2 UTSW 15 74851453 missense probably damaging 1.00
R0522:Cyp11b2 UTSW 15 74851684 splice site probably benign
R0674:Cyp11b2 UTSW 15 74855544 missense probably damaging 1.00
R0837:Cyp11b2 UTSW 15 74853641 missense probably damaging 1.00
R1386:Cyp11b2 UTSW 15 74851775 critical splice acceptor site probably null
R1423:Cyp11b2 UTSW 15 74853130 missense probably damaging 1.00
R1550:Cyp11b2 UTSW 15 74853593 missense probably benign 0.07
R3437:Cyp11b2 UTSW 15 74855449 missense probably benign
R3693:Cyp11b2 UTSW 15 74856008 missense probably benign 0.00
R4447:Cyp11b2 UTSW 15 74855563 missense probably benign 0.00
R4870:Cyp11b2 UTSW 15 74853146 missense probably benign 0.00
R4947:Cyp11b2 UTSW 15 74851570 missense possibly damaging 0.46
R4968:Cyp11b2 UTSW 15 74854005 splice site probably null
R5115:Cyp11b2 UTSW 15 74855428 critical splice donor site probably null
R5775:Cyp11b2 UTSW 15 74853478 missense probably benign 0.02
R6738:Cyp11b2 UTSW 15 74853514 missense possibly damaging 0.65
R6841:Cyp11b2 UTSW 15 74855491 missense probably benign 0.00
R6942:Cyp11b2 UTSW 15 74856245 start gained probably benign
R6997:Cyp11b2 UTSW 15 74851432 missense probably damaging 1.00
R7094:Cyp11b2 UTSW 15 74853658 missense possibly damaging 0.94
R7096:Cyp11b2 UTSW 15 74855988 missense probably damaging 0.98
R7275:Cyp11b2 UTSW 15 74853991 missense probably damaging 1.00
R7456:Cyp11b2 UTSW 15 74853530 missense probably benign 0.01
R7604:Cyp11b2 UTSW 15 74853750 splice site probably null
R8002:Cyp11b2 UTSW 15 74856032 missense probably damaging 1.00
R8222:Cyp11b2 UTSW 15 74856210 missense probably benign 0.03
R8346:Cyp11b2 UTSW 15 74851768 missense probably damaging 1.00
R8349:Cyp11b2 UTSW 15 74851579 missense possibly damaging 0.94
R8449:Cyp11b2 UTSW 15 74851579 missense possibly damaging 0.94
R8537:Cyp11b2 UTSW 15 74856167 missense probably benign 0.01
R8785:Cyp11b2 UTSW 15 74852112 missense probably benign 0.44
R9072:Cyp11b2 UTSW 15 74853813 missense possibly damaging 0.56
R9100:Cyp11b2 UTSW 15 74851146 missense probably damaging 0.99
R9501:Cyp11b2 UTSW 15 74851112 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTACTGGAGAATGGCAG -3'
(R):5'- GTCGAACAGTGCAGGATATTTAGG -3'

Sequencing Primer
(F):5'- TACTGGAGAATGGCAGCACCTC -3'
(R):5'- TATTTAGGCAAGATAAAAGGCTGTG -3'
Posted On 2021-07-15