Incidental Mutation 'R8824:Rapgef3'
ID 673351
Institutional Source Beutler Lab
Gene Symbol Rapgef3
Ensembl Gene ENSMUSG00000022469
Gene Name Rap guanine nucleotide exchange factor (GEF) 3
Synonyms 2310016P22Rik, 9330170P05Rik, Epac1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock # R8824 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 97744770-97767972 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 97766908 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 25 (A25T)
Ref Sequence ENSEMBL: ENSMUSP00000116426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126854] [ENSMUST00000128775] [ENSMUST00000129223] [ENSMUST00000134885] [ENSMUST00000135080] [ENSMUST00000146620] [ENSMUST00000149419] [ENSMUST00000175894] [ENSMUST00000177352]
AlphaFold Q8VCC8
Predicted Effect probably benign
Transcript: ENSMUST00000126854
AA Change: A25T

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116426
Gene: ENSMUSG00000022469
AA Change: A25T

DomainStartEndE-ValueType
DEP 111 186 2.05e-25 SMART
low complexity region 197 208 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
cNMP 245 364 2.53e-12 SMART
RasGEFN 383 514 7.04e-10 SMART
Blast:RasGEF 547 644 6e-45 BLAST
RasGEF 661 926 7.98e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128775
AA Change: A25T

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120126
Gene: ENSMUSG00000022469
AA Change: A25T

DomainStartEndE-ValueType
DEP 111 186 2.05e-25 SMART
low complexity region 197 208 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
cNMP 245 364 2.53e-12 SMART
RasGEFN 383 514 7.04e-10 SMART
Blast:RasGEF 547 644 7e-45 BLAST
RasGEF 661 909 5.53e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129223
AA Change: A25T

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118148
Gene: ENSMUSG00000022469
AA Change: A25T

DomainStartEndE-ValueType
DEP 111 186 2.05e-25 SMART
low complexity region 197 208 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
cNMP 245 364 2.53e-12 SMART
RasGEFN 383 514 7.04e-10 SMART
Blast:RasGEF 547 644 6e-45 BLAST
RasGEF 661 918 2.11e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134885
SMART Domains Protein: ENSMUSP00000135317
Gene: ENSMUSG00000022469

DomainStartEndE-ValueType
RasGEF 1 216 2.91e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135080
AA Change: A25T

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000146620
SMART Domains Protein: ENSMUSP00000116673
Gene: ENSMUSG00000022469

DomainStartEndE-ValueType
DEP 69 144 2.05e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149419
Predicted Effect possibly damaging
Transcript: ENSMUST00000175894
AA Change: A25T

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000177352
SMART Domains Protein: ENSMUSP00000135238
Gene: ENSMUSG00000022469

DomainStartEndE-ValueType
DEP 69 144 2.05e-25 SMART
low complexity region 155 166 N/A INTRINSIC
low complexity region 188 199 N/A INTRINSIC
cNMP 203 322 2.53e-12 SMART
RasGEFN 341 472 7.04e-10 SMART
Blast:RasGEF 505 602 3e-45 BLAST
RasGEF 619 884 7.98e-95 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (63/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased induced neuron apoptosis. Mice homozygous for a different allele exhibit impaired glucose homeostasis with decreased insulin secretion, increased susceptibility to diet-induced obesity and streptozotocin-induced insulitis and hyperglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl A T 2: 93,862,850 V260D probably damaging Het
Adora2a G A 10: 75,326,179 A51T probably damaging Het
Afg1l G A 10: 42,438,387 P128S possibly damaging Het
Ago4 C A 4: 126,507,184 V623L probably benign Het
Akap11 A T 14: 78,516,347 N112K Het
C1ra A T 6: 124,517,695 I306F probably damaging Het
Ccdc73 A G 2: 104,991,877 N724D possibly damaging Het
Cd248 A G 19: 5,069,617 I498V probably benign Het
Clrn1 A T 3: 58,884,893 S50T probably benign Het
Col7a1 A G 9: 108,967,025 K1553R unknown Het
Cxcr6 A C 9: 123,810,941 T343P probably benign Het
Cyp11b2 T A 15: 74,856,065 Q56L probably damaging Het
Dip2a A G 10: 76,278,486 probably null Het
Dnmbp A G 19: 43,849,837 V742A probably benign Het
Dusp16 A T 6: 134,739,769 S192T probably benign Het
Ehbp1 A T 11: 22,232,053 D87E probably damaging Het
Fgl1 A G 8: 41,199,711 V150A probably benign Het
Flt3 T C 5: 147,334,863 D873G probably damaging Het
Gart T C 16: 91,630,703 D469G possibly damaging Het
Gm28168 T G 1: 117,947,895 S85A probably benign Het
Golgb1 A G 16: 36,915,689 D1807G probably benign Het
Grm8 A G 6: 27,761,352 L291S probably damaging Het
Gucy2d C T 7: 98,443,469 P18S possibly damaging Het
Ifna15 C T 4: 88,557,761 C162Y probably damaging Het
Iqub C A 6: 24,479,308 E412* probably null Het
Krt4 T A 15: 101,920,642 D312V Het
Krtap26-1 A T 16: 88,647,415 I106N probably damaging Het
Krtap26-1 T C 16: 88,647,436 Y99C probably damaging Het
Lipn T C 19: 34,084,716 I357T probably benign Het
Lrrc14b A G 13: 74,363,949 L4P probably damaging Het
Mrgpra9 A T 7: 47,235,293 C209S probably benign Het
Myh7b A G 2: 155,630,381 N1291D probably benign Het
Myo5a A G 9: 75,167,046 T746A probably damaging Het
Myom2 A C 8: 15,114,169 E1021D possibly damaging Het
Ncoa2 C T 1: 13,177,185 R338H probably benign Het
Ncor2 A G 5: 125,118,757 F91L Het
Neb C G 2: 52,216,911 A4407P probably damaging Het
Olfr1135 T C 2: 87,671,960 M136V possibly damaging Het
Olfr1272 A G 2: 90,296,012 I283T probably damaging Het
Olfr347 A T 2: 36,735,191 Y290F probably damaging Het
Olfr502 T G 7: 108,523,143 Y269S probably benign Het
Olfr74 A G 2: 87,974,003 F221L probably benign Het
Olfr819 C T 10: 129,965,792 V297M probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Piwil4 C A 9: 14,727,475 K298N probably benign Het
Prkcz G A 4: 155,344,828 probably benign Het
Prkg2 G A 5: 98,942,208 P691L possibly damaging Het
Ptprc T A 1: 138,113,708 K89* probably null Het
Rreb1 C T 13: 37,930,516 T617I probably damaging Het
Rsph1 A C 17: 31,273,376 V72G possibly damaging Het
Shc2 A G 10: 79,637,702 V50A probably benign Het
Slc38a9 G A 13: 112,701,487 R262H probably benign Het
Slco6c1 T A 1: 97,128,159 N6Y possibly damaging Het
Smarca5 A G 8: 80,705,332 F886L probably benign Het
Tas1r2 A G 4: 139,653,763 probably benign Het
Tnrc6c T A 11: 117,739,854 probably benign Het
Trim30b T A 7: 104,357,906 probably benign Het
Trim55 T C 3: 19,672,962 S398P probably benign Het
Ttc39c T A 18: 12,686,946 probably benign Het
Ubxn10 A G 4: 138,735,867 probably null Het
Usf3 A G 16: 44,215,613 N152S probably benign Het
Vps13b T A 15: 35,533,299 V839E probably damaging Het
Zeb1 T A 18: 5,748,680 probably benign Het
Zfp780b T C 7: 27,963,468 Y554C probably benign Het
Zhx2 C T 15: 57,821,280 T15I probably damaging Het
Other mutations in Rapgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Rapgef3 APN 15 97748223 missense probably damaging 1.00
IGL01339:Rapgef3 APN 15 97758059 missense probably damaging 1.00
IGL01670:Rapgef3 APN 15 97749662 missense probably benign 0.15
IGL01902:Rapgef3 APN 15 97750300 missense probably benign 0.32
IGL02137:Rapgef3 APN 15 97750144 missense probably benign 0.08
IGL02419:Rapgef3 APN 15 97750290 missense probably benign 0.33
IGL02427:Rapgef3 APN 15 97747136 splice site probably null
IGL02648:Rapgef3 APN 15 97758392 missense probably damaging 1.00
IGL02834:Rapgef3 APN 15 97748265 missense probably damaging 0.98
IGL03389:Rapgef3 APN 15 97749516 missense probably damaging 1.00
IGL03055:Rapgef3 UTSW 15 97749489 splice site probably benign
R0394:Rapgef3 UTSW 15 97757819 intron probably benign
R0538:Rapgef3 UTSW 15 97757817 intron probably benign
R0744:Rapgef3 UTSW 15 97761585 splice site probably benign
R1288:Rapgef3 UTSW 15 97759342 missense probably benign 0.31
R1512:Rapgef3 UTSW 15 97757501 missense probably benign 0.24
R1676:Rapgef3 UTSW 15 97761182 missense probably benign 0.35
R1745:Rapgef3 UTSW 15 97750178 missense probably benign 0.22
R1928:Rapgef3 UTSW 15 97750033 missense probably damaging 1.00
R2063:Rapgef3 UTSW 15 97766961 missense probably damaging 1.00
R2067:Rapgef3 UTSW 15 97766961 missense probably damaging 1.00
R2092:Rapgef3 UTSW 15 97760723 missense probably damaging 1.00
R4358:Rapgef3 UTSW 15 97748648 missense probably benign 0.05
R4624:Rapgef3 UTSW 15 97758929 missense probably damaging 1.00
R4627:Rapgef3 UTSW 15 97758929 missense probably damaging 1.00
R4727:Rapgef3 UTSW 15 97760600 missense probably damaging 1.00
R4812:Rapgef3 UTSW 15 97753803 missense probably benign 0.21
R4928:Rapgef3 UTSW 15 97757375 missense probably damaging 1.00
R5161:Rapgef3 UTSW 15 97757725 missense probably damaging 1.00
R5442:Rapgef3 UTSW 15 97758861 missense probably damaging 0.99
R5652:Rapgef3 UTSW 15 97758437 missense probably benign 0.00
R5837:Rapgef3 UTSW 15 97757342 splice site probably benign
R6056:Rapgef3 UTSW 15 97758861 missense probably damaging 0.99
R6167:Rapgef3 UTSW 15 97767411 unclassified probably benign
R6694:Rapgef3 UTSW 15 97759984 missense probably benign 0.03
R7039:Rapgef3 UTSW 15 97761568 missense probably benign 0.01
R7154:Rapgef3 UTSW 15 97753877 missense probably benign
R7380:Rapgef3 UTSW 15 97766791 missense probably benign 0.00
R7655:Rapgef3 UTSW 15 97761209 missense probably damaging 1.00
R7656:Rapgef3 UTSW 15 97761209 missense probably damaging 1.00
R7754:Rapgef3 UTSW 15 97757746 missense probably damaging 1.00
R7849:Rapgef3 UTSW 15 97758390 critical splice donor site probably null
R8061:Rapgef3 UTSW 15 97761520 missense probably benign
R8117:Rapgef3 UTSW 15 97750866 missense probably benign 0.01
R8179:Rapgef3 UTSW 15 97760740 missense probably benign 0.06
R8819:Rapgef3 UTSW 15 97748657 missense probably benign 0.39
R8820:Rapgef3 UTSW 15 97748657 missense probably benign 0.39
R9779:Rapgef3 UTSW 15 97745598 missense probably damaging 0.99
R9781:Rapgef3 UTSW 15 97745598 missense probably damaging 0.99
R9782:Rapgef3 UTSW 15 97745598 missense probably damaging 0.99
RF024:Rapgef3 UTSW 15 97760740 missense probably benign 0.06
X0011:Rapgef3 UTSW 15 97761473 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AATTTGCTCTGGAGAAAGCTGCC -3'
(R):5'- CATGACCAGTCCAAGTCCAG -3'

Sequencing Primer
(F):5'- TGGAGAAAGCTGCCTGGCC -3'
(R):5'- TCCAGAGGACGCTAAGCCAG -3'
Posted On 2021-07-15