Incidental Mutation 'R8824:Krtap26-1'
ID 673356
Institutional Source Beutler Lab
Gene Symbol Krtap26-1
Ensembl Gene ENSMUSG00000071471
Gene Name keratin associated protein 26-1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R8824 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 88646824-88647796 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88647436 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 99 (Y99C)
Ref Sequence ENSEMBL: ENSMUSP00000093626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095934]
AlphaFold Q9D7N2
Predicted Effect probably damaging
Transcript: ENSMUST00000095934
AA Change: Y99C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093626
Gene: ENSMUSG00000071471
AA Change: Y99C

DomainStartEndE-ValueType
Pfam:PMG 4 213 2.9e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl A T 2: 93,862,850 V260D probably damaging Het
Adora2a G A 10: 75,326,179 A51T probably damaging Het
Afg1l G A 10: 42,438,387 P128S possibly damaging Het
Ago4 C A 4: 126,507,184 V623L probably benign Het
Akap11 A T 14: 78,516,347 N112K Het
C1ra A T 6: 124,517,695 I306F probably damaging Het
Ccdc73 A G 2: 104,991,877 N724D possibly damaging Het
Cd248 A G 19: 5,069,617 I498V probably benign Het
Clrn1 A T 3: 58,884,893 S50T probably benign Het
Col7a1 A G 9: 108,967,025 K1553R unknown Het
Cxcr6 A C 9: 123,810,941 T343P probably benign Het
Cyp11b2 T A 15: 74,856,065 Q56L probably damaging Het
Dip2a A G 10: 76,278,486 probably null Het
Dnmbp A G 19: 43,849,837 V742A probably benign Het
Dusp16 A T 6: 134,739,769 S192T probably benign Het
Ehbp1 A T 11: 22,232,053 D87E probably damaging Het
Fgl1 A G 8: 41,199,711 V150A probably benign Het
Flt3 T C 5: 147,334,863 D873G probably damaging Het
Gart T C 16: 91,630,703 D469G possibly damaging Het
Gm28168 T G 1: 117,947,895 S85A probably benign Het
Golgb1 A G 16: 36,915,689 D1807G probably benign Het
Grm8 A G 6: 27,761,352 L291S probably damaging Het
Gucy2d C T 7: 98,443,469 P18S possibly damaging Het
Ifna15 C T 4: 88,557,761 C162Y probably damaging Het
Iqub C A 6: 24,479,308 E412* probably null Het
Krt4 T A 15: 101,920,642 D312V Het
Lipn T C 19: 34,084,716 I357T probably benign Het
Lrrc14b A G 13: 74,363,949 L4P probably damaging Het
Mrgpra9 A T 7: 47,235,293 C209S probably benign Het
Myh7b A G 2: 155,630,381 N1291D probably benign Het
Myo5a A G 9: 75,167,046 T746A probably damaging Het
Myom2 A C 8: 15,114,169 E1021D possibly damaging Het
Ncoa2 C T 1: 13,177,185 R338H probably benign Het
Ncor2 A G 5: 125,118,757 F91L Het
Neb C G 2: 52,216,911 A4407P probably damaging Het
Olfr1135 T C 2: 87,671,960 M136V possibly damaging Het
Olfr1272 A G 2: 90,296,012 I283T probably damaging Het
Olfr347 A T 2: 36,735,191 Y290F probably damaging Het
Olfr502 T G 7: 108,523,143 Y269S probably benign Het
Olfr74 A G 2: 87,974,003 F221L probably benign Het
Olfr819 C T 10: 129,965,792 V297M probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Piwil4 C A 9: 14,727,475 K298N probably benign Het
Prkcz G A 4: 155,344,828 probably benign Het
Prkg2 G A 5: 98,942,208 P691L possibly damaging Het
Ptprc T A 1: 138,113,708 K89* probably null Het
Rapgef3 C T 15: 97,766,908 A25T probably benign Het
Rreb1 C T 13: 37,930,516 T617I probably damaging Het
Rsph1 A C 17: 31,273,376 V72G possibly damaging Het
Shc2 A G 10: 79,637,702 V50A probably benign Het
Slc38a9 G A 13: 112,701,487 R262H probably benign Het
Slco6c1 T A 1: 97,128,159 N6Y possibly damaging Het
Smarca5 A G 8: 80,705,332 F886L probably benign Het
Tas1r2 A G 4: 139,653,763 probably benign Het
Tnrc6c T A 11: 117,739,854 probably benign Het
Trim30b T A 7: 104,357,906 probably benign Het
Trim55 T C 3: 19,672,962 S398P probably benign Het
Ttc39c T A 18: 12,686,946 probably benign Het
Ubxn10 A G 4: 138,735,867 probably null Het
Usf3 A G 16: 44,215,613 N152S probably benign Het
Vps13b T A 15: 35,533,299 V839E probably damaging Het
Zeb1 T A 18: 5,748,680 probably benign Het
Zfp780b T C 7: 27,963,468 Y554C probably benign Het
Zhx2 C T 15: 57,821,280 T15I probably damaging Het
Other mutations in Krtap26-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Krtap26-1 APN 16 88647379 missense possibly damaging 0.62
IGL01721:Krtap26-1 APN 16 88647172 missense probably damaging 1.00
IGL01963:Krtap26-1 APN 16 88647668 missense probably damaging 1.00
IGL02524:Krtap26-1 APN 16 88647479 missense possibly damaging 0.70
R0383:Krtap26-1 UTSW 16 88647243 nonsense probably null
R2367:Krtap26-1 UTSW 16 88647325 missense probably benign 0.28
R4694:Krtap26-1 UTSW 16 88647220 missense possibly damaging 0.70
R6699:Krtap26-1 UTSW 16 88647715 missense unknown
R6884:Krtap26-1 UTSW 16 88647579 missense probably damaging 1.00
R7299:Krtap26-1 UTSW 16 88647244 missense possibly damaging 0.49
R7808:Krtap26-1 UTSW 16 88647310 missense not run
R8824:Krtap26-1 UTSW 16 88647415 missense probably damaging 1.00
R9034:Krtap26-1 UTSW 16 88647273 missense probably benign 0.14
R9186:Krtap26-1 UTSW 16 88647721 missense unknown
R9279:Krtap26-1 UTSW 16 88647454 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTGCATCCATAAGTGACAATGC -3'
(R):5'- GCTCTACAAACATGGGCTGTG -3'

Sequencing Primer
(F):5'- TGACAATGCCCAGAGGTCG -3'
(R):5'- TCTACAAACATGGGCTGTGGAGAG -3'
Posted On 2021-07-15