Incidental Mutation 'R8824:Rsph1'
ID 673358
Institutional Source Beutler Lab
Gene Symbol Rsph1
Ensembl Gene ENSMUSG00000024033
Gene Name radial spoke head 1 homolog (Chlamydomonas)
Synonyms MCA, meichroacidin, Tsga2
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8824 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 31255019-31277356 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 31273376 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 72 (V72G)
Ref Sequence ENSEMBL: ENSMUSP00000024832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024832]
AlphaFold Q8VIG3
Predicted Effect possibly damaging
Transcript: ENSMUST00000024832
AA Change: V72G

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000024832
Gene: ENSMUSG00000024033
AA Change: V72G

DomainStartEndE-ValueType
MORN 18 40 3.63e1 SMART
MORN 42 63 9.45e-6 SMART
MORN 65 86 1.67e-6 SMART
MORN 88 109 9.09e-8 SMART
MORN 111 132 7.79e-7 SMART
MORN 135 156 3.21e1 SMART
Pfam:MORN 159 181 8e-5 PFAM
low complexity region 227 242 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a male meiotic metaphase chromosome-associated acidic protein. This gene is expressed in tissues with motile cilia or flagella, including the trachea, lungs, airway brushings, and testes. Mutations in this gene result in primary ciliary dyskinesia-24. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit male infertility and azoospermia due to impaired spermatid formation, including deformation of the nucleus/head, acrosome, and flagellar mitochondrial sheath. Homozygous null females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl A T 2: 93,862,850 V260D probably damaging Het
Adora2a G A 10: 75,326,179 A51T probably damaging Het
Afg1l G A 10: 42,438,387 P128S possibly damaging Het
Ago4 C A 4: 126,507,184 V623L probably benign Het
Akap11 A T 14: 78,516,347 N112K Het
C1ra A T 6: 124,517,695 I306F probably damaging Het
Ccdc73 A G 2: 104,991,877 N724D possibly damaging Het
Cd248 A G 19: 5,069,617 I498V probably benign Het
Clrn1 A T 3: 58,884,893 S50T probably benign Het
Col7a1 A G 9: 108,967,025 K1553R unknown Het
Cxcr6 A C 9: 123,810,941 T343P probably benign Het
Cyp11b2 T A 15: 74,856,065 Q56L probably damaging Het
Dip2a A G 10: 76,278,486 probably null Het
Dnmbp A G 19: 43,849,837 V742A probably benign Het
Dusp16 A T 6: 134,739,769 S192T probably benign Het
Ehbp1 A T 11: 22,232,053 D87E probably damaging Het
Fgl1 A G 8: 41,199,711 V150A probably benign Het
Flt3 T C 5: 147,334,863 D873G probably damaging Het
Gart T C 16: 91,630,703 D469G possibly damaging Het
Gm28168 T G 1: 117,947,895 S85A probably benign Het
Golgb1 A G 16: 36,915,689 D1807G probably benign Het
Grm8 A G 6: 27,761,352 L291S probably damaging Het
Gucy2d C T 7: 98,443,469 P18S possibly damaging Het
Ifna15 C T 4: 88,557,761 C162Y probably damaging Het
Iqub C A 6: 24,479,308 E412* probably null Het
Krt4 T A 15: 101,920,642 D312V Het
Krtap26-1 A T 16: 88,647,415 I106N probably damaging Het
Krtap26-1 T C 16: 88,647,436 Y99C probably damaging Het
Lipn T C 19: 34,084,716 I357T probably benign Het
Lrrc14b A G 13: 74,363,949 L4P probably damaging Het
Mrgpra9 A T 7: 47,235,293 C209S probably benign Het
Myh7b A G 2: 155,630,381 N1291D probably benign Het
Myo5a A G 9: 75,167,046 T746A probably damaging Het
Myom2 A C 8: 15,114,169 E1021D possibly damaging Het
Ncoa2 C T 1: 13,177,185 R338H probably benign Het
Ncor2 A G 5: 125,118,757 F91L Het
Neb C G 2: 52,216,911 A4407P probably damaging Het
Olfr1135 T C 2: 87,671,960 M136V possibly damaging Het
Olfr1272 A G 2: 90,296,012 I283T probably damaging Het
Olfr347 A T 2: 36,735,191 Y290F probably damaging Het
Olfr502 T G 7: 108,523,143 Y269S probably benign Het
Olfr74 A G 2: 87,974,003 F221L probably benign Het
Olfr819 C T 10: 129,965,792 V297M probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Piwil4 C A 9: 14,727,475 K298N probably benign Het
Prkcz G A 4: 155,344,828 probably benign Het
Prkg2 G A 5: 98,942,208 P691L possibly damaging Het
Ptprc T A 1: 138,113,708 K89* probably null Het
Rapgef3 C T 15: 97,766,908 A25T probably benign Het
Rreb1 C T 13: 37,930,516 T617I probably damaging Het
Shc2 A G 10: 79,637,702 V50A probably benign Het
Slc38a9 G A 13: 112,701,487 R262H probably benign Het
Slco6c1 T A 1: 97,128,159 N6Y possibly damaging Het
Smarca5 A G 8: 80,705,332 F886L probably benign Het
Tas1r2 A G 4: 139,653,763 probably benign Het
Tnrc6c T A 11: 117,739,854 probably benign Het
Trim30b T A 7: 104,357,906 probably benign Het
Trim55 T C 3: 19,672,962 S398P probably benign Het
Ttc39c T A 18: 12,686,946 probably benign Het
Ubxn10 A G 4: 138,735,867 probably null Het
Usf3 A G 16: 44,215,613 N152S probably benign Het
Vps13b T A 15: 35,533,299 V839E probably damaging Het
Zeb1 T A 18: 5,748,680 probably benign Het
Zfp780b T C 7: 27,963,468 Y554C probably benign Het
Zhx2 C T 15: 57,821,280 T15I probably damaging Het
Other mutations in Rsph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02156:Rsph1 APN 17 31258116 missense probably benign 0.30
IGL02729:Rsph1 APN 17 31273319 missense probably damaging 1.00
IGL03380:Rsph1 APN 17 31277236 missense unknown
R1493:Rsph1 UTSW 17 31265899 missense probably damaging 1.00
R1714:Rsph1 UTSW 17 31255216 missense probably benign 0.03
R5319:Rsph1 UTSW 17 31273377 missense probably benign 0.02
R6172:Rsph1 UTSW 17 31273418 missense probably benign 0.02
R6729:Rsph1 UTSW 17 31277252 missense unknown
R8167:Rsph1 UTSW 17 31277286 start gained probably benign
R8807:Rsph1 UTSW 17 31265854 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATTTCCTGGTCGATCAGTG -3'
(R):5'- ACATGGGAAAGCACGACTGC -3'

Sequencing Primer
(F):5'- CCTGGTCGATCAGTGAACTTG -3'
(R):5'- CACATATGAAGGAAGCTATGAGTTTG -3'
Posted On 2021-07-15