Incidental Mutation 'R8825:Itih5'
ID 673364
Institutional Source Beutler Lab
Gene Symbol Itih5
Ensembl Gene ENSMUSG00000025780
Gene Name inter-alpha (globulin) inhibitor H5
Synonyms 5430408M01Rik, 4631408O11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R8825 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 10153571-10256529 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 10190420 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 208 (S208G)
Ref Sequence ENSEMBL: ENSMUSP00000026886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026886]
AlphaFold Q8BJD1
Predicted Effect probably benign
Transcript: ENSMUST00000026886
AA Change: S208G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026886
Gene: ENSMUSG00000025780
AA Change: S208G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
Pfam:VIT 51 159 5.5e-27 PFAM
VWA 293 476 5.84e-24 SMART
Pfam:ITI_HC_C 716 909 1.7e-60 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavy chain component of one of the inter-alpha-trypsin inhibitor (ITI) family members. ITI proteins are involved in extracellular matrix stabilization and in the prevention of tumor metastasis. They are also structurally related plasma serine protease inhibitors and are composed of a light chain and varying numbers of heavy chains. This family member is thought to function as a tumor suppressor in breast and thyroid cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik T C 11: 29,823,696 E587G probably benign Het
5430403G16Rik T G 5: 109,678,880 T5P probably damaging Het
A430078G23Rik T A 8: 3,386,951 L247Q probably damaging Het
Arfgap2 T A 2: 91,273,561 L334Q probably damaging Het
Birc6 T A 17: 74,613,505 C2100S probably damaging Het
Bpi A G 2: 158,267,750 D206G probably benign Het
C6 T C 15: 4,731,688 I10T possibly damaging Het
Cactin A G 10: 81,325,658 T675A probably damaging Het
Cbwd1 A G 19: 24,949,237 V150A probably benign Het
Cd200 G A 16: 45,394,794 R165C probably benign Het
Cdkal1 C T 13: 29,354,794 V461I probably benign Het
Ces2g C T 8: 104,967,322 S430F probably benign Het
Clcn3 A T 8: 60,929,488 H382Q probably damaging Het
Crem A T 18: 3,268,061 V89E probably damaging Het
Crtc2 T A 3: 90,259,156 M146K probably benign Het
Depdc1b T G 13: 108,384,782 D374E possibly damaging Het
Dgkg T A 16: 22,562,769 H477L probably benign Het
Dnhd1 T A 7: 105,693,967 V1506D possibly damaging Het
Exosc10 G A 4: 148,568,702 probably null Het
Flnb G T 14: 7,887,566 G459C probably damaging Het
Gm4881 A G 7: 24,929,257 V60A possibly damaging Het
Golgb1 A G 16: 36,919,447 D2757G probably benign Het
Gsta4 T G 9: 78,208,839 probably benign Het
Herc2 T A 7: 56,050,878 M1K probably null Het
Hip1 C T 5: 135,422,122 V879M probably damaging Het
Htt T C 5: 34,825,960 Y968H probably benign Het
Ints11 T A 4: 155,885,130 Y154* probably null Het
Lamb2 C T 9: 108,485,261 T701I probably benign Het
Lgals3 T A 14: 47,380,100 Y22* probably null Het
Macc1 T A 12: 119,445,852 D118E probably benign Het
Mad2l2 T C 4: 148,140,820 L9P probably damaging Het
Mark2 T C 19: 7,341,206 T6A probably benign Het
Mcat T C 15: 83,552,611 N143S probably benign Het
Med10 T G 13: 69,813,927 C144G unknown Het
Miga1 A T 3: 152,276,823 F539I probably damaging Het
Mon2 A T 10: 123,013,871 S1174T probably benign Het
Mycbp2 C A 14: 103,229,435 W1330C probably damaging Het
Myo5b T C 18: 74,759,098 S1612P possibly damaging Het
Nipal4 T C 11: 46,162,046 I31V probably benign Het
Obox3 A T 7: 15,627,301 V13E possibly damaging Het
Olfr703 A T 7: 106,845,429 I273F probably damaging Het
Olfr967 T C 9: 39,750,698 F104S probably damaging Het
Ppic A G 18: 53,409,150 V162A probably damaging Het
Prkg2 T C 5: 98,942,184 K699R probably benign Het
Prl2c2 T A 13: 13,005,071 L6F possibly damaging Het
Rnf148 G C 6: 23,654,379 S206C probably benign Het
Sec16a A G 2: 26,423,574 S474P Het
Sema5a T G 15: 32,689,352 H1054Q probably benign Het
Slc6a18 C A 13: 73,665,632 V521F probably null Het
Stat2 T A 10: 128,291,364 D921E possibly damaging Het
Tcf24 G T 1: 9,960,999 N42K unknown Het
Tgfb2 T A 1: 186,628,939 N372Y probably damaging Het
Tktl2 A C 8: 66,513,667 M626L possibly damaging Het
Tmem94 A G 11: 115,797,375 D1220G probably benign Het
Trcg1 A G 9: 57,241,471 T109A probably benign Het
Trim30a T A 7: 104,411,322 K416* probably null Het
Trpm5 T C 7: 143,083,016 K395E possibly damaging Het
Ufm1 T A 3: 53,863,672 probably null Het
Unc13b T A 4: 43,237,683 probably benign Het
Vmn2r16 T C 5: 109,339,153 V80A probably benign Het
Vmn2r77 A T 7: 86,803,647 Y524F probably benign Het
Zfp64 T C 2: 168,951,632 S65G probably benign Het
Other mutations in Itih5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Itih5 APN 2 10190289 missense probably damaging 1.00
IGL02125:Itih5 APN 2 10240987 missense probably benign
IGL02370:Itih5 APN 2 10186975 missense probably benign 0.05
IGL03376:Itih5 APN 2 10206773 missense probably benign 0.12
IGL02991:Itih5 UTSW 2 10251351 missense probably benign 0.01
R0090:Itih5 UTSW 2 10164684 missense probably benign 0.03
R0096:Itih5 UTSW 2 10251378 missense probably benign 0.02
R0096:Itih5 UTSW 2 10251378 missense probably benign 0.02
R0158:Itih5 UTSW 2 10234992 splice site probably benign
R0270:Itih5 UTSW 2 10251264 missense probably benign 0.38
R0276:Itih5 UTSW 2 10185564 missense possibly damaging 0.80
R0807:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0810:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0903:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0905:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0906:Itih5 UTSW 2 10249188 missense probably benign 0.00
R1104:Itih5 UTSW 2 10251512 missense probably benign 0.03
R1397:Itih5 UTSW 2 10240807 missense probably benign 0.14
R1671:Itih5 UTSW 2 10186971 missense probably benign 0.03
R1971:Itih5 UTSW 2 10238568 missense probably damaging 1.00
R3684:Itih5 UTSW 2 10238624 missense possibly damaging 0.93
R3685:Itih5 UTSW 2 10238624 missense possibly damaging 0.93
R3831:Itih5 UTSW 2 10251270 missense possibly damaging 0.95
R3934:Itih5 UTSW 2 10245544 missense probably damaging 0.98
R4670:Itih5 UTSW 2 10190369 missense probably benign 0.01
R4803:Itih5 UTSW 2 10240581 missense probably benign
R4950:Itih5 UTSW 2 10235081 missense probably damaging 0.98
R5020:Itih5 UTSW 2 10240504 splice site probably null
R5735:Itih5 UTSW 2 10240761 missense probably benign 0.00
R6454:Itih5 UTSW 2 10240668 missense probably benign
R6662:Itih5 UTSW 2 10249181 missense probably benign 0.13
R7019:Itih5 UTSW 2 10190327 missense probably damaging 1.00
R7068:Itih5 UTSW 2 10249304 missense probably damaging 0.99
R7246:Itih5 UTSW 2 10187062 splice site probably null
R7424:Itih5 UTSW 2 10245637 missense probably damaging 1.00
R7452:Itih5 UTSW 2 10238796 missense probably damaging 1.00
R7597:Itih5 UTSW 2 10249376 missense probably damaging 1.00
R8025:Itih5 UTSW 2 10241022 missense probably benign 0.13
R8253:Itih5 UTSW 2 10238595 missense probably benign 0.06
R8349:Itih5 UTSW 2 10186989 missense probably benign 0.01
R8439:Itih5 UTSW 2 10235058 missense probably benign 0.19
R8449:Itih5 UTSW 2 10186989 missense probably benign 0.01
R9110:Itih5 UTSW 2 10187020 missense probably benign
R9582:Itih5 UTSW 2 10190202 missense probably benign 0.07
X0026:Itih5 UTSW 2 10238559 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAGGACAAAGCTGCTTTCTTCC -3'
(R):5'- ACATCTCTTGGTGGAATCTGG -3'

Sequencing Primer
(F):5'- CCTCAGTTATGAAGAGCTTCTGCAG -3'
(R):5'- ACAAACTCCTGTCTTTGCTTTGTAAC -3'
Posted On 2021-07-15